Q: The first land plants were __________. a. gnetophytes b
The first land plants were __________. a. gnetophytes b. gymnosperms c. bryophytes d. lycophytes
See AnswerQ: Moss sperm can swim, but plant ecologist Nils Cronberg suspected that
Moss sperm can swim, but plant ecologist Nils Cronberg suspected that they sometimes hitch a ride on crawling insects or mites (tiny animals related to spiders). To test this hypothesis he carried out...
See AnswerQ: A waxy cuticle helps land plants ________. a. conserve water
A waxy cuticle helps land plants ________. a. conserve water b. take up carbon dioxide c. reproduce d. stand upright
See AnswerQ: True or false? Ferns produce seeds inside sori.
True or false? Ferns produce seeds inside sori.
See AnswerQ: Refer to Figure 9.7, then translate the following mRNA
Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAU GCUCGUUGGAUUAAUUGU—3′
See AnswerQ: Lignin and vascular tissue first evolved in relatives of club moss,
Lignin and vascular tissue first evolved in relatives of club moss, and some extinct species stood 40 meters (130 feet) high. Explain how the evolution of vascular tissues and lignin would have allowe...
See AnswerQ: 1. In cells, most RNA molecules are ______; most DNA
1. In cells, most RNA molecules are ______; most DNA molecules are ______. a. single-stranded; double-stranded b. double-stranded; single-stranded 2. RNAs form by __________; proteins form by _______...
See AnswerQ: _____ attach mosses to soil. a. Rhizoids b
_____ attach mosses to soil. a. Rhizoids b. Rhizomes c. Roots d. Strobili
See AnswerQ: Bryophytes alone have a relatively large _______ and an attached, dependent
Bryophytes alone have a relatively large _______ and an attached, dependent ______. a. sporophyte; gametophyte b. gametophyte; sporophyte
See AnswerQ: Club mosses, horsetails, and ferns are _______ plants.
Club mosses, horsetails, and ferns are _______ plants. a. multicelled aquatic b. nonvascular seed c. seedless vascular d. seed-bearing vascular
See Answer
