Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAU GCUCGUUGGAUUAAUUGU—3′
> Horseshoe crab blood clots immediately upon exposure to bacterial toxins, so it can be used to test injectable drugs for the presence of dangerous bacteria. To keep horseshoe crab populations stable, blood is extracted from captured animals, which are th
> Horseshoe crab blood clots immediately upon exposure to bacterial toxins, so it can be used to test injectable drugs for the presence of dangerous bacteria. To keep horseshoe crab populations stable, blood is extracted from captured animals, which are th
> A rise in atmospheric carbon dioxide increases ocean acidity, making it harder for animals to build calcium carbonate parts. List some invertebrate animals that increased ocean acidity could harm in this way.
> Energy that drives translation is provided mainly by __________. a. ATP b. amino acids c. GTP d. all are correct
> True or false? Animal cells do not have walls.
> Â Horseshoe crab blood clots immediately upon exposure to bacterial toxins, so it can be used to test injectable drugs for the presence of dangerous bacteria. To keep horseshoe crab populations stable, blood is extracted from captured animals,
> A massive die-off of lobsters in the Long Island Sound was blamed on pesticides sprayed to control mosquitoes that carry West Nile virus. Why might a chemical designed to kill insects also harm lobsters but have no effect on sea stars?
> An abundance of ________ in Earth’s early atmosphere would have interfered with assembly of organic compounds. a. carbon dioxide b. ammonia c. water d. oxygen
> Some people think that many of our uniquely human traits arose by sexual selection. Over thousands of years, women attracted to charming, witty men perhaps prompted the development of human intellect beyond what was necessary for mere survival. Men attra
> The astronomer Carl Sagan once said, “We are made of star stuff.” Explain why this is true of all life on Earth.
> Researchers looking for fossils of the earliest life forms face many hurdles. For example, few sedimentary rocks date back more than 3 billion years. Review what you learned about plate tectonics (Section 16.7). Explain why so few remaining samples of th
> A person is declared dead upon the irreversible ceasing of spontaneous body functions: brain activity, blood circulation, and respiration. Only about 1 percent of a body’s cells have to die in order for all of these things to happen. How can a person be
> The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed to infect bacteria. The virus–bacteria mixtures
> 1. Electrophoresis separates fragments of DNA according to ______. a. sequence b. length c. species 2. PCR can be used __________. a. to increase the number of specific DNA fragments b. in DNA fingerprinting c. to modify a human genome d. a and b are co
> Formation of a(n) ______ allows some soil bacteria to survive adverse conditions. a. pilus b. nucleoid c. endospore d. plasmid
> Match the terms appropriately. club fungus a. first discovered in a chitin soil-dwelling sac fungus b. component of fungal cell walls - penicillin - sac fungus - zygote fungus lichen c. partnership between a fungus and one or more photoautotrophs d.
> 1. Unlike eukaryotic cells, prokaryotic cells ______. a. have no nucleus b. have RNA but not DNA c. have no ribosomes d. a and c 2. Enzymes contained in ______ break down worn-out organelles, bacteria, and other particles. a. lysosomes b. amyloplasts c.
> Budding is a mechanism of ______ in yeasts. a. extracellular digestion b. asexual reproduction c. defense d. toxin production
> All ______ form partnerships with plant roots. a. Glomeromycetes b. Chytrids c. Microsporidia d. Club fungi
> Fungal infections are most common in ______. a. plants b. insects c. mammals d. birds
> ______ are fungi that live as intracellular parasites. a. Glomeromycetes b. Chytrids c. Microsporidia d. Club fungi
> Some nitrogen-fixing cyanobacteria can partner with a fungus to form a ______. a. mycelium b. lichen c. mycorrhiza d. fruiting body
> are fungi that produce flagellated spores. a. Chytrids b. Sac fungi c. Zygote fungi d. Club fungi
> Two species of antelope, one from Africa, the other from Asia, are put into the same enclosure in a zoo. To the zookeeper’s surprise, individuals of the different species begin to mate and produce healthy, hybrid baby antelopes. Explain why a biologist m
> Spores released from a mushroom’s gills are ______. a. flagellated b. produced by mitosis c. dikaryotic d. haploid
> A mushroom is ______. a. a fungal digestive organ b. the only part of the fungal body made of hyphae c. a reproductive structure that releases sexual spores d. made of haploid hyphae
> The mycelium of a multicelled fungus is a mesh of filaments, each called a _______. a. septa b. hypha c. spore
> No animal cell has a ______. a. plasma membrane b. flagellum c. lysosome d. cell wall
> In most ______, an extensive dikaryotic mycelium is the longest-lived phase of the life cycle. a. chytrids b. zygote fungi c. sac fungi d. club fungi
> The yeasts whose fermentation reactions produce the carbon dioxide that makes bread rise are a type of _______. a. chytrid b. zygote fungus c. sac fungus d. club fungus
> Health professionals refer to fungal skin diseases as “tineas” and name them according to the region affected (TABLE 23.1). Fungal skin diseases are persistent, in part because fungi can penetrate deeper layers of skin
> Most fungi obtain nutrients from _______. a. nonliving organic matter b. living plants c. living animals d. photosynthesis
> Researchers working in a Brazilian rain forest recently found eight species of bioluminescent mushrooms at a single site. The mushrooms continually emit a faint glow that, although undetectable in daylight, makes them visible at night. Suggest a mechanis
> Bacteria that serve as decomposers are ______. a. photoautotrophs b. photoheterotrophs c. chemoautotrophs d. chemoheterotrophs
> One cell transfers a plasmid to another by _________. a. binary fission b. transformation c. conjugation d. the lytic pathway
> Species have traditionally been characterized as “primitive” and “advanced.” For example, mosses were considered to be primitive, and flowering plants advanced; crocodiles were primitive and mammals were advanced. Why do most biologists of today think it
> Bacteria and archaea reproduce by ______. a. binary fission b. transformation c. conjugation d. the lytic pathway
> The genetic material of HIV (a retrovirus) is ______. a. DNA b. RNA c. protein d. lipids
> Which of the following organelles contains no DNA? a. nucleus b. Golgi body c. mitochondrion d. chloroplast
> Place these groups in order of their appearance with the oldest lineage first and the most recently evolved last. a. ferns b. сусads c. eudicots _1 2 .3 4 d. mosses ||||
> Match the terms appropriately. -bryophyte a. has seeds, but no fruits seedless vascular b. has flowers and fruits c. has xylem and phloem, but no pollen d. no xylem or phloem plant gymnosperm -angiosperm
> Which angiosperm lineage includes the most species? a. magnoliids b. eudicots c. monocots d. water lilies
> A seed is a(n) _______. a. female gametophyte b. mature ovule c. mature pollen tube d. immature microspore
> Coal consists primarily of compressed remains of the _______ that dominated Carboniferous swamp forests. a. seedless vascular plants b. conifers c. flowering plants d. hornworts
> Club mosses, horsetails, and ferns are _______ plants. a. multicelled aquatic b. nonvascular seed c. seedless vascular d. seed-bearing vascular
> Bryophytes alone have a relatively large _______ and an attached, dependent ______. a. sporophyte; gametophyte b. gametophyte; sporophyte
> _____ attach mosses to soil. a. Rhizoids b. Rhizomes c. Roots d. Strobili
> 1. In cells, most RNA molecules are ______; most DNA molecules are ______. a. single-stranded; double-stranded b. double-stranded; single-stranded 2. RNAs form by __________; proteins form by ____________. a. replication; translation b. translation; tra
> Lignin and vascular tissue first evolved in relatives of club moss, and some extinct species stood 40 meters (130 feet) high. Explain how the evolution of vascular tissues and lignin would have allowed a dramatic increase in plant height. How might being
> True or false? Ferns produce seeds inside sori.
> A waxy cuticle helps land plants ________. a. conserve water b. take up carbon dioxide c. reproduce d. stand upright
> Moss sperm can swim, but plant ecologist Nils Cronberg suspected that they sometimes hitch a ride on crawling insects or mites (tiny animals related to spiders). To test this hypothesis he carried out an experiment. He placed patches of male and female m
> The first land plants were __________. a. gnetophytes b. gymnosperms c. bryophytes d. lycophytes
> Insect-Assisted Fertilization in Moss Moss sperm can swim, but plant ecologist Nils Cronberg suspected that they sometimes hitch a ride on crawling insects or mites (tiny animals related to spiders). To test this hypothesis he carried out an
> Early botanists admired ferns but found their life cycle perplexing. In the 1700s, they learned to propagate ferns by sowing what appeared to be tiny dustlike “seeds” from the undersides of fronds. Despite many attempts, the scientists could not find the
> Bioluminescent dinoflagellates ______. a. have a clear silica shell b. emit light when disturbed c. live inside most corals d. are multicelled heterotrophs
> The choanoflagellates are considered the sister group to, or closest living relatives of, ___________. a. plants b. fungi c. animals d. dinoflagellates
> Each position of a codon can be occupied by one of four nucleotides. What is the minimum number of nucleotides per codon necessary to specify all 20 of the amino acids that are typical of eukaryotic proteins?
> Radiolarians and diatoms have a shell of ___________. a. cellulose b. silica c. calcium carbonate d. chitin
> Closed stomata ______. a. limit gas exchange b. permit water loss c. prevent photosynthesis d. absorb light
> Which groups of protists would you be most likely to find as fossils? Why?
> _____ is the technique of determining the order of nucleotide bases in a sample of DNA. a. PCR b. Sequencing c. Electrophoresis d. Nucleic acid hybridization
> A set of cells that host various DNA fragments collectively representing an organism’s entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
> For each species, all ______ in the complete set of chromosomes is the ______. a. genomes; library b. DNA; genome c. mRNA; start of cDNA d. cDNA; start of mRNA
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> Reverse transcriptase assembles a(n) ________ on a(n) _______ template. a. mRNA; DNA c. DNA; ribosome b. cDNA; mRNA d. protein; mRNA
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> A binding site for RNA polymerase is called a __________. a. gene b. promoter c. codon d. protein
> Which of the following substances does not participate in the Calvin–Benson cycle? a. ATP b. NADPH c. RuBP d. PGAL e. O2 f. CO2
> ______ cut(s) DNA molecules at specific sites. a. DNA polymerase b. DNA probes c. Restriction enzymes d. Reverse transcriptase
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> In 1918, an influenza pandemic that originated with avian flu killed 50 million people. Researchers isolated samples of that virus from bodies of infected people preserved in Alaskan permafrost since 1918. From the samples, they sequenced the viral genom
> 1. The spindle attaches to chromosomes at the __________. a. centriole b. contractile ring c. centromere d. centrosome 2. Only ________ is not a stage of mitosis. a. prophase b. interphase c. metaphase d. anaphase 3. In intervals of interphase, G stan
> 1. Which is not a nucleotide base in DNA? a. adenine b. glutamine c. guanine d. thymine e. cytosine f. all are in DNA 2. What are the base-pairing rules for DNA? a. A–G, T–C b. A–T, G–C c. A–C, T–G d. A–A, G–G, C–C, T–T 3. In eukaryotic chromosomes, DN
> The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed to infect bacteria. The virus–bacteria mixtures
> Determine the complementary strand of DNA that forms on this template DNA fragment during replication: 5'-GGTTTCTTCAAGAGA-3'
> When a photosystem absorbs light, _______. a. sugar phosphates are produced b. electrons are transferred to ATP c. RuBP accepts electrons d. electrons are ejected from its special pair
> In C3 plants ______, makes sugar production inefficient when stomata close during the day. a. photosynthesis b. photolysis c. photorespiration d. carbon fixation
> Which of the following statements is incorrect? a. Pigments absorb light of certain wavelengths only. b. Some accessory pigments are antioxidants. c. Chlorophyll is green because it absorbs green light.
> The higher the altitude, the lower the oxygen level in air. Climbers of very tall mountains risk altitude sickness, which is characterized by shortness of breath, weakness, dizziness, and confusion. The early symptoms of cyanide poisoning are the same as
> 1. Entropy ______. a. disperses b. is a measure of disorder c. always increases, overall d. b and c 2. A metabolic pathway ______. a. may build or break down molecules b. generates heat c. can include redox reactions d. all of the above 3. A transport
> What are the main sources of youth crime data?
> Discuss the differences among legal, social, and psychological definitions of delinquency.
> Provide examples of five minority or gender issues relating to law enforcement.
> Give examples of each of the four types of stressors that are common in law enforcement.
> List and describe briefly the six personality measures currently most used in police screening.
> Summarize each side of the argument as to whether an expert should provide an opinion on the “ultimate issue.”
> Briefly explain the difference between the Frye general acceptance standard and the Daubert standard for evaluating expert testimony.
> Discuss the tasks psychologists perform in witness preparation. What are the pros and cons of psychologists participating in these tasks, particularly as they relate to lay witnesses?
> List any five findings from the research on a. stalking and b. bullying.
> Define hate or bias crime and tell how the criminal justice system has responded to these crimes.
> Discuss the significance of the Supreme Court cases Kent v. United States and In re Gault to juveniles charged with criminal offenses.
> Describe the four major categories of workplace violence.
> Why is the term workplace violence somewhat of a misnomer?
> What are the two major types of mass murder?
> List and define the typologies of serial killers.
> Distinguish among single murder, serial murder, mass murder, and spree murder.
> Summarize the negative effects of constant viewing of violence in the media.