Question: Autism is a neurobiological disorder with symptoms
Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory.
Mutations in the gene for neuroligin 3, an adhesion protein that connects brain cells, have been associated with autism. One of these mutations is called R451C because the altered gene encodes a protein with an amino acid substitution: a cysteine (C) instead of an arginine (R) in position 451.
In 2007, Katsuhiko Tabuchi and his colleagues introduced the R451C mutation into the neuroligin 3 gene of mice. The researchers discovered that the genetically modified mice had impaired social behavior and superior spatial learning ability.
Spatial learning in mice is tested with a water maze, which consists of a small platform submerged a bit below the surface of a pool of water so it is invisible to a swimming mouse. Mice do not particularly enjoy swimming, so they try to locate the hidden platform as quickly as they can. When tested again later, they remember the platform’s location by checking visual cues around the edge of the pool. How quickly they remember is a measure of their spatial learning ability. FIGURE 15.14 shows some of Tabuchi’s results.
FIGURE 15.14 Spatial learning ability in mice. Mice with a mutation in neuroligin 3 (R451C ) were tested for learning performance as compared with unmodified (wild-type) mice.
Did the modified or the unmodified mice learn the location of the platform faster in the first test?
Transcribed Image Text:
wild-type R451C a water maze First test Second test Days of training required to reach platform in 10 sec 4. 2.
> ______ are fungi that live as intracellular parasites. a. Glomeromycetes b. Chytrids c. Microsporidia d. Club fungi
> Some nitrogen-fixing cyanobacteria can partner with a fungus to form a ______. a. mycelium b. lichen c. mycorrhiza d. fruiting body
> are fungi that produce flagellated spores. a. Chytrids b. Sac fungi c. Zygote fungi d. Club fungi
> Two species of antelope, one from Africa, the other from Asia, are put into the same enclosure in a zoo. To the zookeeper’s surprise, individuals of the different species begin to mate and produce healthy, hybrid baby antelopes. Explain why a biologist m
> Spores released from a mushroom’s gills are ______. a. flagellated b. produced by mitosis c. dikaryotic d. haploid
> A mushroom is ______. a. a fungal digestive organ b. the only part of the fungal body made of hyphae c. a reproductive structure that releases sexual spores d. made of haploid hyphae
> The mycelium of a multicelled fungus is a mesh of filaments, each called a _______. a. septa b. hypha c. spore
> No animal cell has a ______. a. plasma membrane b. flagellum c. lysosome d. cell wall
> In most ______, an extensive dikaryotic mycelium is the longest-lived phase of the life cycle. a. chytrids b. zygote fungi c. sac fungi d. club fungi
> The yeasts whose fermentation reactions produce the carbon dioxide that makes bread rise are a type of _______. a. chytrid b. zygote fungus c. sac fungus d. club fungus
> Health professionals refer to fungal skin diseases as “tineas” and name them according to the region affected (TABLE 23.1). Fungal skin diseases are persistent, in part because fungi can penetrate deeper layers of skin
> Most fungi obtain nutrients from _______. a. nonliving organic matter b. living plants c. living animals d. photosynthesis
> Researchers working in a Brazilian rain forest recently found eight species of bioluminescent mushrooms at a single site. The mushrooms continually emit a faint glow that, although undetectable in daylight, makes them visible at night. Suggest a mechanis
> Bacteria that serve as decomposers are ______. a. photoautotrophs b. photoheterotrophs c. chemoautotrophs d. chemoheterotrophs
> One cell transfers a plasmid to another by _________. a. binary fission b. transformation c. conjugation d. the lytic pathway
> Species have traditionally been characterized as “primitive” and “advanced.” For example, mosses were considered to be primitive, and flowering plants advanced; crocodiles were primitive and mammals were advanced. Why do most biologists of today think it
> Bacteria and archaea reproduce by ______. a. binary fission b. transformation c. conjugation d. the lytic pathway
> The genetic material of HIV (a retrovirus) is ______. a. DNA b. RNA c. protein d. lipids
> Which of the following organelles contains no DNA? a. nucleus b. Golgi body c. mitochondrion d. chloroplast
> Place these groups in order of their appearance with the oldest lineage first and the most recently evolved last. a. ferns b. сусads c. eudicots _1 2 .3 4 d. mosses ||||
> Match the terms appropriately. -bryophyte a. has seeds, but no fruits seedless vascular b. has flowers and fruits c. has xylem and phloem, but no pollen d. no xylem or phloem plant gymnosperm -angiosperm
> Which angiosperm lineage includes the most species? a. magnoliids b. eudicots c. monocots d. water lilies
> A seed is a(n) _______. a. female gametophyte b. mature ovule c. mature pollen tube d. immature microspore
> Coal consists primarily of compressed remains of the _______ that dominated Carboniferous swamp forests. a. seedless vascular plants b. conifers c. flowering plants d. hornworts
> Club mosses, horsetails, and ferns are _______ plants. a. multicelled aquatic b. nonvascular seed c. seedless vascular d. seed-bearing vascular
> Bryophytes alone have a relatively large _______ and an attached, dependent ______. a. sporophyte; gametophyte b. gametophyte; sporophyte
> _____ attach mosses to soil. a. Rhizoids b. Rhizomes c. Roots d. Strobili
> 1. In cells, most RNA molecules are ______; most DNA molecules are ______. a. single-stranded; double-stranded b. double-stranded; single-stranded 2. RNAs form by __________; proteins form by ____________. a. replication; translation b. translation; tra
> Lignin and vascular tissue first evolved in relatives of club moss, and some extinct species stood 40 meters (130 feet) high. Explain how the evolution of vascular tissues and lignin would have allowed a dramatic increase in plant height. How might being
> Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5′—UGUCAUGCUCGUCUUGAAUCUUGUGAU GCUCGUUGGAUUAAUUGU—3′
> True or false? Ferns produce seeds inside sori.
> A waxy cuticle helps land plants ________. a. conserve water b. take up carbon dioxide c. reproduce d. stand upright
> Moss sperm can swim, but plant ecologist Nils Cronberg suspected that they sometimes hitch a ride on crawling insects or mites (tiny animals related to spiders). To test this hypothesis he carried out an experiment. He placed patches of male and female m
> The first land plants were __________. a. gnetophytes b. gymnosperms c. bryophytes d. lycophytes
> Insect-Assisted Fertilization in Moss Moss sperm can swim, but plant ecologist Nils Cronberg suspected that they sometimes hitch a ride on crawling insects or mites (tiny animals related to spiders). To test this hypothesis he carried out an
> Early botanists admired ferns but found their life cycle perplexing. In the 1700s, they learned to propagate ferns by sowing what appeared to be tiny dustlike “seeds” from the undersides of fronds. Despite many attempts, the scientists could not find the
> Bioluminescent dinoflagellates ______. a. have a clear silica shell b. emit light when disturbed c. live inside most corals d. are multicelled heterotrophs
> The choanoflagellates are considered the sister group to, or closest living relatives of, ___________. a. plants b. fungi c. animals d. dinoflagellates
> Each position of a codon can be occupied by one of four nucleotides. What is the minimum number of nucleotides per codon necessary to specify all 20 of the amino acids that are typical of eukaryotic proteins?
> Radiolarians and diatoms have a shell of ___________. a. cellulose b. silica c. calcium carbonate d. chitin
> Closed stomata ______. a. limit gas exchange b. permit water loss c. prevent photosynthesis d. absorb light
> Which groups of protists would you be most likely to find as fossils? Why?
> _____ is the technique of determining the order of nucleotide bases in a sample of DNA. a. PCR b. Sequencing c. Electrophoresis d. Nucleic acid hybridization
> A set of cells that host various DNA fragments collectively representing an organism’s entire set of genetic information is a _________. a. genome b. clone c. genomic library d. GMO
> For each species, all ______ in the complete set of chromosomes is the ______. a. genomes; library b. DNA; genome c. mRNA; start of cDNA d. cDNA; start of mRNA
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> Reverse transcriptase assembles a(n) ________ on a(n) _______ template. a. mRNA; DNA c. DNA; ribosome b. cDNA; mRNA d. protein; mRNA
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> A binding site for RNA polymerase is called a __________. a. gene b. promoter c. codon d. protein
> Which of the following substances does not participate in the Calvin–Benson cycle? a. ATP b. NADPH c. RuBP d. PGAL e. O2 f. CO2
> ______ cut(s) DNA molecules at specific sites. a. DNA polymerase b. DNA probes c. Restriction enzymes d. Reverse transcriptase
> Autism is a neurobiological disorder with symptoms that include impaired social interactions and repetitive, stereotyped patterns of behavior. Around 10 percent of autistic people also have an extraordinary skill or talent such as greatly enhanced memory
> In 1918, an influenza pandemic that originated with avian flu killed 50 million people. Researchers isolated samples of that virus from bodies of infected people preserved in Alaskan permafrost since 1918. From the samples, they sequenced the viral genom
> 1. The spindle attaches to chromosomes at the __________. a. centriole b. contractile ring c. centromere d. centrosome 2. Only ________ is not a stage of mitosis. a. prophase b. interphase c. metaphase d. anaphase 3. In intervals of interphase, G stan
> 1. Which is not a nucleotide base in DNA? a. adenine b. glutamine c. guanine d. thymine e. cytosine f. all are in DNA 2. What are the base-pairing rules for DNA? a. A–G, T–C b. A–T, G–C c. A–C, T–G d. A–A, G–G, C–C, T–T 3. In eukaryotic chromosomes, DN
> The graph shown in FIGURE 8.5 is reproduced from an original 1952 publication by Hershey and Chase. Bacteriophage were labeled with radioactive tracers and allowed to infect bacteria. The virus–bacteria mixtures
> Determine the complementary strand of DNA that forms on this template DNA fragment during replication: 5'-GGTTTCTTCAAGAGA-3'
> When a photosystem absorbs light, _______. a. sugar phosphates are produced b. electrons are transferred to ATP c. RuBP accepts electrons d. electrons are ejected from its special pair
> In C3 plants ______, makes sugar production inefficient when stomata close during the day. a. photosynthesis b. photolysis c. photorespiration d. carbon fixation
> Which of the following statements is incorrect? a. Pigments absorb light of certain wavelengths only. b. Some accessory pigments are antioxidants. c. Chlorophyll is green because it absorbs green light.
> The higher the altitude, the lower the oxygen level in air. Climbers of very tall mountains risk altitude sickness, which is characterized by shortness of breath, weakness, dizziness, and confusion. The early symptoms of cyanide poisoning are the same as
> 1. Entropy ______. a. disperses b. is a measure of disorder c. always increases, overall d. b and c 2. A metabolic pathway ______. a. may build or break down molecules b. generates heat c. can include redox reactions d. all of the above 3. A transport
> What are the main sources of youth crime data?
> Discuss the differences among legal, social, and psychological definitions of delinquency.
> Provide examples of five minority or gender issues relating to law enforcement.
> Give examples of each of the four types of stressors that are common in law enforcement.
> List and describe briefly the six personality measures currently most used in police screening.
> Summarize each side of the argument as to whether an expert should provide an opinion on the “ultimate issue.”
> Briefly explain the difference between the Frye general acceptance standard and the Daubert standard for evaluating expert testimony.
> Discuss the tasks psychologists perform in witness preparation. What are the pros and cons of psychologists participating in these tasks, particularly as they relate to lay witnesses?
> List any five findings from the research on a. stalking and b. bullying.
> Define hate or bias crime and tell how the criminal justice system has responded to these crimes.
> Discuss the significance of the Supreme Court cases Kent v. United States and In re Gault to juveniles charged with criminal offenses.
> Describe the four major categories of workplace violence.
> Why is the term workplace violence somewhat of a misnomer?
> What are the two major types of mass murder?
> List and define the typologies of serial killers.
> Distinguish among single murder, serial murder, mass murder, and spree murder.
> Summarize the negative effects of constant viewing of violence in the media.
> Provide illustrations of gender, race, and ethnic differences in violence.
> What are the four categories of the causes of violence discussed in the psychological literature?
> Scientific jury selection is used in major cases but is not prevalent in the typical criminal or civil case. Give at least three reasons why this might be so.
> What are amicus curiae briefs, and why would a psychological association or organization want to file them?
> List and describe briefly assessment roles of forensic psychologists in juvenile justice settings.
> Explain the differences between actuarial predictions, clinical predictions, and structured professional judgment as they relate to assessments of risk.
> Review the main steps or stages of the judicial process and provide illustrations of tasks forensic psychologists might perform at each one.
> What is the significance of Jenkins v. United States to forensic psychology?
> What has job analysis revealed about police work?
> List and define briefly any five psychological measures designed to assess recidivism among adult or juvenile sex offenders.
> Are female juvenile sex offenders different from male juvenile sex offenders? Explain your answer.
> Discuss juvenile sex offenders according to their antisocial conduct, the victims they choose, and their own history of victimization.
> Contrast the MTC and Groth child molester typologies on both their a. classification system and b. research support.
> What are the two basic dimensions on which child molesters are classified according to the MTC:CM?
> Contrast the MTC and the Groth rapist typologies on both their a. classification system and b. research support.
> Why is it important to distinguish between detention and treatment/rehabilitation?
> What six variables have consistently been found to play an important role in the behavior, emotional, and thought patterns of rapists?
> Briefly summarize the MTC:R3 classification system, along with what it is based on.
> What are the demographic features of men who rape?
> Define rape, and explain how and why the term is being replaced by sexual assault in many criminal statutes.
