All Related Questions of Homologous

Q: In 1995, Edward Lanphier founded Sangamo Biosciences for the purpose of

In 1995, Edward Lanphier founded Sangamo Biosciences for the purpose of developing zinc-finger nucleases (ZFNs), a new technology that offered potential for “editingâ€...

See Answer

Q: Starting with acetylene as your only source of carbon atoms, identify

Starting with acetylene as your only source of carbon atoms, identify how you would prepare each member of the following homologous series of aldehydes: a. CH3CHO b. CH3CH2CHO c. CH3CH2CH2CHO d. C...

See Answer

Q: In this example, what is the underlying cause of nonallelic homologous

In this example, what is the underlying cause of nonallelic homologous recombination?

See Answer

Q: Explain why these homologous chromosomes can synapse only if an inversion loop

Explain why these homologous chromosomes can synapse only if an inversion loop forms.

See Answer

Q: At which stage do homologous chromosomes separate from each other?

At which stage do homologous chromosomes separate from each other?

See Answer

Q: Let’s suppose a pea plant is heterozygous for three genes, Tt

Let’s suppose a pea plant is heterozygous for three genes, Tt Yy Rr, and each gene is on a different chromosome. How many different ways could the three pairs of homologous chromosomes line up during...

See Answer

Q: For the following events, specify whether they occur during mitosis,

For the following events, specify whether they occur during mitosis, meiosis I, or meiosis II: A. Separation of conjoined chromatids within a pair of sister chromatids B. Pairing of homologous chrom...

See Answer

Q: Why are the homologous regions of the X and Y chromosome important

Why are the homologous regions of the X and Y chromosome important during meiosis?

See Answer

Q: Discuss why it is useful to search a database to identify sequences

Discuss why it is useful to search a database to identify sequences that are homologous to a newly determined sequence.

See Answer

Q: A multiple-sequence alignment of five homologous proteins is shown here

A multiple-sequence alignment of five homologous proteins is shown here: Discuss some of the interesting features that this alignment reveals.

See Answer

Q: When comparing (i.e., aligning) two or more

When comparing (i.e., aligning) two or more genetic sequences, it is sometimes necessary to put in gaps. Explain why. Discuss two changes (i.e., two types of mutations) that could happen during the ev...

See Answer

Q: The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do n...

See Answer

Q: For each of the following examples, discuss whether the observed result

For each of the following examples, discuss whether the observed result is due to neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of...

See Answer

Q: With regard to the repair of double-strand breaks, what

With regard to the repair of double-strand breaks, what are the advantages and disadvantages of homologous recombination repair versus nonhomologous end joining?

See Answer

Q: Three common ways to repair changes in DNA structure are nucleotide excision

Three common ways to repair changes in DNA structure are nucleotide excision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the foll...

See Answer

Q: Describe the similarities and differences between homologous recombination involving sister chromatid exchange

Describe the similarities and differences between homologous recombination involving sister chromatid exchange (SCE) and that involving homologs. Would you expect the same types of proteins to be invo...

See Answer

Q: The molecular mechanism of SCE is similar to homologous recombination between homologs

The molecular mechanism of SCE is similar to homologous recombination between homologs except that the two segments of DNA are sister chromatids instead of homologous chromatids. If branch migration o...

See Answer

Q: Is homologous recombination an example of mutation? Explain.

Is homologous recombination an example of mutation? Explain.

See Answer

Q: In the Holliday model for homologous recombination, the resolution steps can

In the Holliday model for homologous recombination, the resolution steps can produce recombinant or nonrecombinant chromosomes. Explain how this can occur.

See Answer

Q: A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex

A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers for the 12S rRNA mitochondrial gene, they carried out PCR and obt...

See Answer

Q: A homologous DNA region, which was 20,000 bp in

A homologous DNA region, which was 20,000 bp in length, was sequenced from four different species. The following numbers of nucleotide differences were obtained: Construct a phylogenetic tree that de...

See Answer

Q: Make a list of the similarities and differences among homologous recombination,

Make a list of the similarities and differences among homologous recombination, site-specific recombination, and transposition.

See Answer

Q: If homologous and site-specific recombination could not occur, what

If homologous and site-specific recombination could not occur, what would be the harmful and the beneficial consequences?

See Answer

Q: If you have access to the necessary computer software, make a

If you have access to the necessary computer software, make a sequence file and analyze it in the following ways: What is the translated sequence in all three reading frames? What is the longest open...

See Answer

Q: What is the advantage of genetic recombination, which is depicted in

What is the advantage of genetic recombination, which is depicted in part (b)? From Figure 20.1:

See Answer

Q: Most bats eat insects or fruit. Vampire bats, however,

Most bats eat insects or fruit. Vampire bats, however, suck blood from birds or mammals. Like some snakes, and unlike any other mammals, vampire bats have thermoreceptors that can detect body heat giv...

See Answer