DNA polymerase is one of the most important enzymes involved in DNA replication and it is a complex process that occurs in the living systems prior to the division of cells. The DNA first gets itself duplicated and the cell divides afterwards through mitosis and meiosis.
A new daughter strand is formed from the template strand and the bases present in it are complementary to the bases present in the template strand. Hence, it is known as a semi-conservative process. These bases are added up in the growing strand by DNA polymerase one at a time. Both prokaryotic and eukaryotic cells constitute these polymerases. Some of these polymerases serve the purpose of replicating the DNA strands whereas some are involved in repair mechanisms.
1. True or False: Enzymes known as DNA polymerases assemble
11. ___________ are derived from a combination of up to 20
a. Why is DNA polymerase said to be template-directed
Why is a thermostable form of DNA polymerase (e.g
Three common ways to repair changes in DNA structure are nucleotide excision
The chromosome of E. coli contains 4.6 million bp
Here are two strands of DNA. —————————————— DNA polymerase→
A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC
Discuss the similarities and differences between RNA polymerase (described in this
As described in Table 11.3, what is the difference