Question: Discuss the similarities and differences between

> Discuss the significance of modified bases within tRNA molecules.

> What is an activated amino acid?

> What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” Why has the function of this type of enzyme been described this way?

> What is the end result of crossing over?

> In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?

> Describe the structural features that all tRNA molecules have in common.

> Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′. What type(s) of base modification to this tRNA would allow it to also recognize 5′–AAA–3′?

> If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

> A tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?

> If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.

> How many different sequences of mRNA could encode a peptide with the sequence proline-glycine-methionine-serine?

> The wobble rules for tRNA-mRNA pairing are shown in Figure 13.12. If we assume that the tRNAs do not contain modified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methio

> The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it requires an input of energy for the reaction to proceed. Where does the energy come from to attach amino acids to tRNA molecules?

> In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with the anticodon 3′–ACC–5′. A mutation can change this se

> Eukaryotic cells exhibit compartmentalization. Define compartmentalization. From Figure 3.1: Microfilament Nucleolus Golgi body Nuclear Chromosomal Nucleus envelope DNA Polyribosomes Ribosome Rough endoplasmic reticulum Cytoplasm Membrane protein Pl

> According to the adaptor hypothesis, is each of the following statements true or false? A. The sequence of anticodons in tRNA directly recognizes codon sequences in mRNA, with some room for wobble. B. The amino acid attached to the tRNA directly recogn

> What does it mean when we say that the genetic code is degenerate? Discuss the universality of the genetic code

> An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.

> What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional roles of the different subunits?

> A mutation within a gene sequence changes the start codon to a stop codon. How will this mutation affect the transcription of this gene?

> In Chapter 9, we considered the dimensions of the double helix. In an α helix of a protein, there are 3.6 amino acids per complete turn. Each amino acid advances the α helix by 0.15 nm; a complete turn of an α he

> According to the examples shown in Figure 12.5, which positions of the −35 sequence (i.e., first, second, third, fourth, fifth, or sixth) are more tolerant of changes? Do you think these positions play a more or less important role in t

> Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mu

> What is the consensus sequence of the following six DNA sequences? GGCATTGACT GCCATTGTCA CGCATAGTCA GGAAATGGGA GGCTTTGTCA GGCATAGTCA

> According to the mechanism shown in Figure 12.20, several snRNPs play different roles in the splicing of pre-mRNA. Identify the snRNP that recognizes each of the following sites: A. 5′ splice site B. 3′ splice site

> Do these examples constitute variation in chromosome structure or variation in chromosome number? From Figure 1.9: a. A person with Down syndrome. She has 47 chromosomes rather than the common number of 46, because she has an extra copy of chromosome 2

> In the splicing of group I introns shown in Figure 12.18a, does the 5′ end of the intron have a phosphate group? Explain. From Figure 12.18a: CH,OH H H он он Guanosine Guanosine- Intron binding site Exon 1 G. Exon 2 5 -3' -3 5- 3'

> The processing of ribosomal RNA in eukaryotes is shown in Figure 12.16. Why is this called cleavage or processing but not splicing? From Figure 12.16: Promoter 18S 5.8S 28S 455 FRNA Transcription primary transcript 51 18S 5.8S 28S 3' Cleavage (the l

> Figure 12.21 shows the products of alternative splicing for the α-tropomyosin pre-mRNA. Let’s suppose that smooth muscle cells produce splicing factors that are not produced in other cell types. Explain where you think suc

> What is the function of a splicing factor? Explain how splicing factors can regulate the cell-specific splicing of mRNAs.

> What is alternative splicing? What is its biological significance?

> In eukaryotes, what types of modifications occur to pre-mRNAs?

> What is meant by the term self-splicing? What types of introns are self-splicing?

> What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?

> What does it mean to say that gene expression is colinear?

> What is the unique feature of ribozyme function? Give two examples described in this chapter.

> What are the two different meanings of horizontal lines in a pedigree?

> Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain snRNA. In other words, what do you think is/are the functional role(s) of snRNA during splicing?

> Describe the processing events that occur during the production of tRNA in E. coli.

> A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA

> The initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions—hydrogen bonding, ionic bonding, covalent bonding, and/or hydrophobic interactions—would you

> Which eukaryotic transcription factor(s) shown in Figure 12.14 play(s) a role that is equivalent to that of σ factor in bacterial cells? From Figure 12.14: TFID binds to the TATA box. TFID is a complex of proteins

> Describe the allosteric and torpedo models for transcriptional termination of RNA polymerase II. Which model is more similar to ρ-dependent termination in bacteria and which model is more similar to ρ-independent termination?

> For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing. A. TFIIB B. TFIID C. TFIIH

> What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes? Describe their locations and specific functions.

> In bacteria, what event marks the end of the initiation stage of transcription?

> If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III

> If a parent plant is Ttyy, how many different types of gametes can it make?

> Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination?

> In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.

> Discuss the differences between ρ-dependent and ρ-independent termination.

> Describe what happens to the chemical bonding interactions when transcriptional termination occurs. Be specific about the type of chemical bonding.

> Describe the movement of the open complex along the DNA.

> What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA th

> Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Look a

> At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.

> Explain the central dogma of genetics at the molecular level

> Why does independent assortment promote genetic variation?

> List and briefly describe the three types of functionally important sequences within bacterial origins of replication.

> A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what

> Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of

> The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be ma

> One way that bacterial cells regulate DNA replication is through GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semiconservatively) replicated?

> The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix

> A woman who is heterozygous, Bb, has brown eyes; B (brown) is the dominant allele, and b (blue) is recessive. One of her eyes, however, has a patch of blue color. Give three different explanations for how this might have occurred.

> Meiotic nondisjunction is much more likely than mitotic nondisjunction. Based on this observation, would you conclude that meiotic nondisjunction is usually due to nondisjunction during meiosis I or meiosis II? Explain your reasoning.

> Describe three naturally occurring ways that chromosome number can change.

> An RNA molecule has the following sequence: Parts of region 1 can form a stem-loop with region 2 and with region 3. Can region 1 form a stem-loop with region 2 and region 3 at the same time? Why or why not? Which stem-loop would you predict to be more st

> According to the linkage hypothesis shown here, what is linked? Are two different genes linked, or are two different alleles of the same gene linked, or both? From Figure 2.7: P generation seeds RRYY myy Haploid gametes RY ty F, generation seeds RrY

> As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene expression. For example, the methylation of cytosines may inhibit the transcription of genes. A methylated cytosine base has the following structure: Woul

> Could single-stranded DNA form a stem-loop structure? Why or why not?

> A double-stranded DNA molecule is 1 cm long, and the percentage of adenine in it is 15%. How many cytosines does this DNA molecule contain?

> A medium-sized human chromosome contains about 100 million bp. If the DNA were stretched out in a linear manner, how long would it be?

> The genetic material found within some viruses is single-stranded DNA. Would this genetic material contain equal amounts of A and T and equal amounts of G and C?

> Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly made daughter strand and the other strand is a parental s

> The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded RNA?

> Telomeres contain a 3′ overhang region, as shown in Figure 11.22. Does telomerase require a 3′ overhang to replicate the telomere region? Explain. From Figure 11.22: Telomeric repeat sequences Overhang

> As discussed in Chapter 18, some viruses contain RNA as their genetic material. Certain RNA viruses can exist as a provirus in which the viral genetic material has been inserted into the chromosomal DNA of the host cell. For this to happen, the viral RNA

> A diagram of a linear chromosome is shown here. The end of each strand is labeled with A, B, C, or D. Which ends could not be replicated by DNA polymerase? Why not? 5′–A———————————————————B–3′ 3′–C———————————————————D–5′

> With regard to the T and t alleles, explain what the word segregation means.

> In eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?

> If a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at the beginning of DNA replication?

> As shown in Figure 11.24, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated. From Figure 11.24: Telomere 3' Euk

> What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use

> What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.

> Explain the proofreading function of DNA polymerase.

> With regard to DNA replication, define the term bidirectional replication

> Discuss the similarities and differences in the synthesis of DNA in the lagging and leading strands. What is the advantage of a primosome and a replisome as opposed to having all replication enzymes functioning independently of each other?

> What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?

> Draw a picture that illustrates how DNA helicase works.

> What do we mean when we say a strain is true-breeding?

> Describe the three important functions of DnaA protein

> In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragments. The RNA primers have not yet been removed. A. Whic

> Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding proteins keep the strands separated and yet do not impede th

> A short genetic sequence, which may be recognized by primase, is repeated many times throughout the E. coli chromosome. Researchers have hypothesized that primase may recognize this sequence as a site to begin the synthesis of an RNA primer for DNA repli

> Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. With regard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrect pyrimidine instead of the correct pyri

> Obtain two strings of different colors (e.g., black and white) that are the same length. A length of 20 inches is sufficient. Tie a knot at one end of the black string and another knot at one end of the white string. Each knot designates the 5â&#12

> As shown in Figure 11.5, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-str

> What key structural features of the DNA molecule underlie its ability to be faithfully replicated?

> On rare occasions, a chromosome can suffer a small deletion that removes the centromere. When this occurs, the chromosome usually is not found within subsequent daughter cells. Explain why a chromosome without a centromere is not transmitted very efficie