Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding proteins keep the strands separated and yet do not impede the ability of DNA polymerase to replicate the strands.
> In bacteria, what event marks the end of the initiation stage of transcription?
> If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III
> If a parent plant is Ttyy, how many different types of gametes can it make?
> Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination?
> Discuss the similarities and differences between RNA polymerase (described in this chapter) and DNA polymerase (described in Chapter 11).
> In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.
> Discuss the differences between ρ-dependent and ρ-independent termination.
> Describe what happens to the chemical bonding interactions when transcriptional termination occurs. Be specific about the type of chemical bonding.
> Describe the movement of the open complex along the DNA.
> What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA th
> Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Look a
> At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.
> Explain the central dogma of genetics at the molecular level
> Why does independent assortment promote genetic variation?
> List and briefly describe the three types of functionally important sequences within bacterial origins of replication.
> A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what
> Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of
> The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be ma
> One way that bacterial cells regulate DNA replication is through GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semiconservatively) replicated?
> The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix
> A woman who is heterozygous, Bb, has brown eyes; B (brown) is the dominant allele, and b (blue) is recessive. One of her eyes, however, has a patch of blue color. Give three different explanations for how this might have occurred.
> Meiotic nondisjunction is much more likely than mitotic nondisjunction. Based on this observation, would you conclude that meiotic nondisjunction is usually due to nondisjunction during meiosis I or meiosis II? Explain your reasoning.
> Describe three naturally occurring ways that chromosome number can change.
> An RNA molecule has the following sequence: Parts of region 1 can form a stem-loop with region 2 and with region 3. Can region 1 form a stem-loop with region 2 and region 3 at the same time? Why or why not? Which stem-loop would you predict to be more st
> According to the linkage hypothesis shown here, what is linked? Are two different genes linked, or are two different alleles of the same gene linked, or both? From Figure 2.7: P generation seeds RRYY myy Haploid gametes RY ty F, generation seeds RrY
> As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene expression. For example, the methylation of cytosines may inhibit the transcription of genes. A methylated cytosine base has the following structure: Woul
> Could single-stranded DNA form a stem-loop structure? Why or why not?
> A double-stranded DNA molecule is 1 cm long, and the percentage of adenine in it is 15%. How many cytosines does this DNA molecule contain?
> A medium-sized human chromosome contains about 100 million bp. If the DNA were stretched out in a linear manner, how long would it be?
> The genetic material found within some viruses is single-stranded DNA. Would this genetic material contain equal amounts of A and T and equal amounts of G and C?
> Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly made daughter strand and the other strand is a parental s
> The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded RNA?
> Telomeres contain a 3′ overhang region, as shown in Figure 11.22. Does telomerase require a 3′ overhang to replicate the telomere region? Explain. From Figure 11.22: Telomeric repeat sequences Overhang
> As discussed in Chapter 18, some viruses contain RNA as their genetic material. Certain RNA viruses can exist as a provirus in which the viral genetic material has been inserted into the chromosomal DNA of the host cell. For this to happen, the viral RNA
> A diagram of a linear chromosome is shown here. The end of each strand is labeled with A, B, C, or D. Which ends could not be replicated by DNA polymerase? Why not? 5′–A———————————————————B–3′ 3′–C———————————————————D–5′
> With regard to the T and t alleles, explain what the word segregation means.
> In eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?
> If a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at the beginning of DNA replication?
> As shown in Figure 11.24, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated. From Figure 11.24: Telomere 3' Euk
> What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use
> What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.
> Explain the proofreading function of DNA polymerase.
> With regard to DNA replication, define the term bidirectional replication
> Discuss the similarities and differences in the synthesis of DNA in the lagging and leading strands. What is the advantage of a primosome and a replisome as opposed to having all replication enzymes functioning independently of each other?
> What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?
> Draw a picture that illustrates how DNA helicase works.
> What do we mean when we say a strain is true-breeding?
> Describe the three important functions of DnaA protein
> In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragments. The RNA primers have not yet been removed. A. Whic
> A short genetic sequence, which may be recognized by primase, is repeated many times throughout the E. coli chromosome. Researchers have hypothesized that primase may recognize this sequence as a site to begin the synthesis of an RNA primer for DNA repli
> Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. With regard to pyrimidines and purines, two general types of mistakes are possible. The addition of an incorrect pyrimidine instead of the correct pyri
> Obtain two strings of different colors (e.g., black and white) that are the same length. A length of 20 inches is sufficient. Tie a knot at one end of the black string and another knot at one end of the white string. Each knot designates the 5â
> As shown in Figure 11.5, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-str
> What key structural features of the DNA molecule underlie its ability to be faithfully replicated?
> On rare occasions, a chromosome can suffer a small deletion that removes the centromere. When this occurs, the chromosome usually is not found within subsequent daughter cells. Explain why a chromosome without a centromere is not transmitted very efficie
> How are two topoisomers different from each other? How are they the same?
> In this experiment, which plant, the white- or purple flowered one, is providing the egg cells, and which is providing the sperm cells.
> Describe the role of DNA in the synthesis of a polypeptide.
> Try to explain the function of DNA gyrase with a drawing.
> Take two pieces of string that are approximately 10 inches long, and create a double helix by wrapping them around each other to make 10 complete turns. Tape one end of the strings to a table, and now twist the strings three times (360° each time) in a r
> Coumarins and quinolones are two classes of drugs that inhibit bacterial growth by directly inhibiting DNA gyrase. Discuss two reasons why inhibiting DNA gyrase also inhibits bacterial growth.
> Why is DNA supercoiling called supercoiling rather than just coiling? Why is positive supercoiling called overwinding and negative supercoiling called underwinding? How would you define the terms positive and negative supercoiling for Z DNA (described in
> Describe the mechanisms by which bacterial DNA becomes compacted
> What chemical group (phosphate group, hydroxyl group, or a nitrogenous base) is found at the 3′ end of a DNA strand? What group is found at the 5′ end?
> As the minor and major grooves wind around a DNA double helix, do they ever intersect each other, or do they always run parallel to each other?
> A double-stranded DNA molecule contains 560 nucleotides. How many complete turns occur in this double helix?
> In what ways are the structures of an α helix in a protein and the double helix of DNA similar, and in what ways are they different?
> What is an SMC complex? Describe two examples.
> Which types of macromolecules are found in chromosomes?
> Discuss the differences between the compaction levels of metaphase chromosomes and those of interphase chromosomes. When would you expect gene transcription and DNA replication to take place, during M phase or interphase? Explain why.
> Which of the following terms should not be used to describe a Barr body? A. Chromatin B. Euchromatin C. Heterochromatin D. Chromosome E. Genome
> A typical eukaryotic chromosome found in humans contains about 100 million bp. As noted in Chapter 9, one DNA base pair has a linear length of 0.34 nm. A. What is the linear length of the DNA in a typical human chromosome in micrometers? B. What is the
> What are the roles of the core histone proteins and of histone H1 in the compaction of eukaryotic DNA?
> In Part II of this text, we considered inheritance patterns for diploid eukaryotic species. Bacteria frequently contain two or more nucleoids. With regard to genes and alleles, how is a bacterium that contains two nucleoids similar to a diploid eukaryoti
> In Figure 10.12, what are we looking at in part (b)? Is this an 11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNA come from a cell during M phase or interphase? From Figure 10.12b: 0.5 pm
> Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
> What types of genetic activities occur during interphase? Explain why these activities cannot occur during M phase.
> Compare the structure and cell localization of chromosomes during interphase and M phase
> Compare heterochromatin and euchromatin. What are the differences between them?
> Is DNA a small molecule, a macromolecule, or an organelle?
> Draw a picture depicting the binding between the nuclear matrix and a MAR.
> Beginning with the G1 phase of the cell cycle, describe the level of compaction of the eukaryotic chromosome. How does the level of compaction change as the cell progresses through the cell cycle? Why is it necessary to further compact the chromatin duri
> Describe the structures of a nucleosome and a 30-nm fiber
> Describe the characteristics of highly repetitive DNA sequences.
> What is the function of a centromere? At what stage of the cell cycle would you expect the centromere to be the most important?
> What is a bacterial nucleoid? With regard to cellular membranes, what is the difference between a bacterial nucleoid and a eukaryotic nucleus?
> What is meant by the term DNA sequence?
> If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
> Describe how bases interact with each other in the double helix. This description should include the concepts of complementarity, hydrogen bonding, and base stacking.
> Draw the structure of a phosphodiester linkage.
> Why is it useful to sort male mosquitoes from females?
> Draw the structures of guanine, guanosine, and deoxyguanosine triphosphate
> What are the building blocks of a nucleotide? With regard to the 5′ and 3′ positions on a sugar molecule, how are nucleotides linked together to form a strand of DNA?
> Look up the meaning of the word transformation in a dictionary and explain whether it is an appropriate word to describe the transfer of genetic material from one organism to another.
> Within a protein, certain amino acids are positively charged (e.g., lysine and arginine), some are negatively charged (e.g., glutamate and aspartate), some are polar but uncharged, and some are nonpolar. If you knew that a DNA-binding protein was recogni
> A DNA-binding protein recognizes the following double-stranded sequence: 5′–GCCCGGGC–3′ 3′–CGGGCCCG–5′ This type of double-stranded structure could also occur within the stem region of an RNA stem-loop. Discuss the structural differences between RNA and
> On further analysis of the DNA described in conceptual question C21, you discover that the triplex DNA in this alien organism is composed of a double helix with a third strand wound within the major groove (just like the DNA in Figure 9.15). How would yo
> Let’s suppose you have recently identified an organism that was scraped from an asteroid that hit the earth. (Fortunately, no one was injured.) When you analyze this organism, you discover that its DNA is a triple helix, composed of six different nucleot
> An organism has a G + C content of 64% in its DNA. What are the percentages of A, T, G, and C?
> After the DNA from type S bacteria is exposed to type R bacteria, list all of the steps that you think must occur for the type R bacteria to start making a capsule.
