Question: Mutations in bacterial promoters may increase or
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. As shown in Figure 12.5, the sequence of the −10 site of the promoter for the lac operon is TATGTT. Would you expect the following mutations to be up-promoter or down-promoter mutations?
A. TATGTT to TATATT
B. TATGTT to TTTGTT
C. TATGTT to TATGAT
From Figure 12.5:
Transcribed Image Text:
-35 sequence -10 sequence +1 Transcribed loc operon TTTACA N7 TATGTT N. A loci GCGCAA N7 CATGAT N, A trp operon TTGACA Ng TTAACT N, A rrnX TTGTCT Nis TAATAT N, A recA TTGATA Nis TATAAT N, A lexA TTCCAA N7 TATACT N. A TRNA TTTACA Ni5 TATGAT N, A Consensus TTGACA ТАТААТ sequence
> Meiotic nondisjunction usually occurs during meiosis I. What is not separating properly: bivalents or sister chromatids? What is not separating properly during mitotic nondisjunction?
> What is an allodiploid? What factor determines the fertility of an allodiploid? Why are allotetraploids more likely than allodiploids to be fertile?
> After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each othe
> Explain what is meant by the coupling of transcription and translation in bacteria. Does coupling occur in bacterial and/or eukaryotic cells? Explain.
> An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide is a tryptophan codon. A mutation in the gene that encodes this polypeptide changes this tryptophan codon into a stop codon. How many amino acids would be
> Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions a
> Referring to Figure 13.17, explain why the ribosome translocates along the mRNA in the 5′ to 3′ direction rather than the 3′ to 5′ direction. From Figure 13.17: Ribosome a E sit
> How is this attachment of chromosomes to kinetochore microtubules different from their attachment during metaphase of mitosis?
> What is a polysome?
> In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A. A tRNA without an amino acid attached B. A tRNA with a polypeptide attached C. A tRNA with a single amino acid attached
> What is the function of the nucleolus?
> Which steps during the translation of bacterial mRNA involve an interaction between complementary strands of RNA?
> An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carboxyl-terminus.
> Explain the functional roles of the A, P, and E sites during translation.
> For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG
> How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA that provide an optimal context for a start codon.
> For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF2 B. eIF4 C. eIF5
> Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.
> How do the four cells at the end of meiosis differ from the original mother cell?
> Which two amino acids do you think are the least soluble in water?
> What are the three stages of translation? Discuss the main events that occur during these three stages.
> Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits? A. mRNA-tRNA recognition B. Peptidyl transfer reaction C. Exit of the polype
> The term subunit can be used in a variety of ways. What is the difference between a protein subunit and a ribosomal subunit?
> Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the subunits occurs within living cells.
> List the components required for translation. Describe the relative sizes of these different components. In other words, which components are small molecules, macromolecules, or assemblies of macromolecules?
> Is it necessary for a cell to make 61 different tRNA molecules, corresponding to the 61 codons for amino acids? Explain your answer.
> How and when does formylmethionine become attached to the initiator tRNA in bacteria?
> Discuss the significance of modified bases within tRNA molecules.
> What is an activated amino acid?
> What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” Why has the function of this type of enzyme been described this way?
> What is the end result of crossing over?
> In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?
> Describe the structural features that all tRNA molecules have in common.
> Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′. What type(s) of base modification to this tRNA would allow it to also recognize 5′–AAA–3′?
> If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?
> A tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?
> If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.
> How many different sequences of mRNA could encode a peptide with the sequence proline-glycine-methionine-serine?
> The wobble rules for tRNA-mRNA pairing are shown in Figure 13.12. If we assume that the tRNAs do not contain modified bases, what is the minimum number of tRNAs needed to recognize the codons for the following types of amino acids? A. Leucine B. Methio
> The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it requires an input of energy for the reaction to proceed. Where does the energy come from to attach amino acids to tRNA molecules?
> In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with the anticodon 3′–ACC–5′. A mutation can change this se
> Eukaryotic cells exhibit compartmentalization. Define compartmentalization. From Figure 3.1: Microfilament Nucleolus Golgi body Nuclear Chromosomal Nucleus envelope DNA Polyribosomes Ribosome Rough endoplasmic reticulum Cytoplasm Membrane protein Pl
> According to the adaptor hypothesis, is each of the following statements true or false? A. The sequence of anticodons in tRNA directly recognizes codon sequences in mRNA, with some room for wobble. B. The amino acid attached to the tRNA directly recogn
> What does it mean when we say that the genetic code is degenerate? Discuss the universality of the genetic code
> An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.
> What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional roles of the different subunits?
> A mutation within a gene sequence changes the start codon to a stop codon. How will this mutation affect the transcription of this gene?
> In Chapter 9, we considered the dimensions of the double helix. In an α helix of a protein, there are 3.6 amino acids per complete turn. Each amino acid advances the α helix by 0.15 nm; a complete turn of an α he
> According to the examples shown in Figure 12.5, which positions of the −35 sequence (i.e., first, second, third, fourth, fifth, or sixth) are more tolerant of changes? Do you think these positions play a more or less important role in t
> What is the consensus sequence of the following six DNA sequences? GGCATTGACT GCCATTGTCA CGCATAGTCA GGAAATGGGA GGCTTTGTCA GGCATAGTCA
> According to the mechanism shown in Figure 12.20, several snRNPs play different roles in the splicing of pre-mRNA. Identify the snRNP that recognizes each of the following sites: A. 5′ splice site B. 3′ splice site
> Do these examples constitute variation in chromosome structure or variation in chromosome number? From Figure 1.9: a. A person with Down syndrome. She has 47 chromosomes rather than the common number of 46, because she has an extra copy of chromosome 2
> In the splicing of group I introns shown in Figure 12.18a, does the 5′ end of the intron have a phosphate group? Explain. From Figure 12.18a: CH,OH H H он он Guanosine Guanosine- Intron binding site Exon 1 G. Exon 2 5 -3' -3 5- 3'
> The processing of ribosomal RNA in eukaryotes is shown in Figure 12.16. Why is this called cleavage or processing but not splicing? From Figure 12.16: Promoter 18S 5.8S 28S 455 FRNA Transcription primary transcript 51 18S 5.8S 28S 3' Cleavage (the l
> Figure 12.21 shows the products of alternative splicing for the α-tropomyosin pre-mRNA. Let’s suppose that smooth muscle cells produce splicing factors that are not produced in other cell types. Explain where you think suc
> What is the function of a splicing factor? Explain how splicing factors can regulate the cell-specific splicing of mRNAs.
> What is alternative splicing? What is its biological significance?
> In eukaryotes, what types of modifications occur to pre-mRNAs?
> What is meant by the term self-splicing? What types of introns are self-splicing?
> What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?
> What does it mean to say that gene expression is colinear?
> What is the unique feature of ribozyme function? Give two examples described in this chapter.
> What are the two different meanings of horizontal lines in a pedigree?
> Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain snRNA. In other words, what do you think is/are the functional role(s) of snRNA during splicing?
> Describe the processing events that occur during the production of tRNA in E. coli.
> A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA
> The initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions—hydrogen bonding, ionic bonding, covalent bonding, and/or hydrophobic interactions—would you
> Which eukaryotic transcription factor(s) shown in Figure 12.14 play(s) a role that is equivalent to that of σ factor in bacterial cells? From Figure 12.14: TFID binds to the TATA box. TFID is a complex of proteins
> Describe the allosteric and torpedo models for transcriptional termination of RNA polymerase II. Which model is more similar to ρ-dependent termination in bacteria and which model is more similar to ρ-independent termination?
> For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing. A. TFIIB B. TFIID C. TFIIH
> What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes? Describe their locations and specific functions.
> In bacteria, what event marks the end of the initiation stage of transcription?
> If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III
> If a parent plant is Ttyy, how many different types of gametes can it make?
> Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What types of mutations would prevent ρ-dependent termination?
> Discuss the similarities and differences between RNA polymerase (described in this chapter) and DNA polymerase (described in Chapter 11).
> In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.
> Discuss the differences between ρ-dependent and ρ-independent termination.
> Describe what happens to the chemical bonding interactions when transcriptional termination occurs. Be specific about the type of chemical bonding.
> Describe the movement of the open complex along the DNA.
> What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA th
> Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Look a
> At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.
> Explain the central dogma of genetics at the molecular level
> Why does independent assortment promote genetic variation?
> List and briefly describe the three types of functionally important sequences within bacterial origins of replication.
> A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what
> Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of
> The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be ma
> One way that bacterial cells regulate DNA replication is through GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semiconservatively) replicated?
> The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil and change adenine to hypoxanthine. A DNA double helix
> A woman who is heterozygous, Bb, has brown eyes; B (brown) is the dominant allele, and b (blue) is recessive. One of her eyes, however, has a patch of blue color. Give three different explanations for how this might have occurred.
> Meiotic nondisjunction is much more likely than mitotic nondisjunction. Based on this observation, would you conclude that meiotic nondisjunction is usually due to nondisjunction during meiosis I or meiosis II? Explain your reasoning.
> Describe three naturally occurring ways that chromosome number can change.
> An RNA molecule has the following sequence: Parts of region 1 can form a stem-loop with region 2 and with region 3. Can region 1 form a stem-loop with region 2 and region 3 at the same time? Why or why not? Which stem-loop would you predict to be more st
> According to the linkage hypothesis shown here, what is linked? Are two different genes linked, or are two different alleles of the same gene linked, or both? From Figure 2.7: P generation seeds RRYY myy Haploid gametes RY ty F, generation seeds RrY
> As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene expression. For example, the methylation of cytosines may inhibit the transcription of genes. A methylated cytosine base has the following structure: Woul
> Could single-stranded DNA form a stem-loop structure? Why or why not?
> A double-stranded DNA molecule is 1 cm long, and the percentage of adenine in it is 15%. How many cytosines does this DNA molecule contain?
> A medium-sized human chromosome contains about 100 million bp. If the DNA were stretched out in a linear manner, how long would it be?
