Question: Why is a thermostable form of DNA

> A particular disease is found in a group of South American Indians. During the 1920s, many of these people migrated to Central America. In the Central American group, the disease is never found. Discuss whether or not you think the disease has a genetic

> Which of these mechanisms causes the TE to increase in number?

> What is meant by the term genetic testing? How do testing at the protein level and testing at the DNA level differ? Describe five different techniques used in genetic testing.

> Section 25.1 discussed the types of experimental observations that suggest a disease is inherited. Which of these observations do you find the least convincing? Which do you find the most convincing? Explain your answer.

> Which of the following experimental observations suggest that a disease has a genetic basis? A. The frequency of the disease is less likely in relatives that live apart compared with relatives that live together. B. The frequency of the disease is unus

> Contigs are often made using BAC or cosmid vectors. What are the advantages and disadvantages of these two types of vectors? Which type of contig would you make first, a BAC or cosmid contig? Explain.

> What is a contig? Explain how you would determine that two clones in a contig are overlapping.

> A researcher is interested in a gene found on human chromosome 21. Describe the expected results of a FISH experiment using a probe that is complementary to this gene. How many spots would you see if the probe was used on a sample from an individual with

> Explain how DNA probes with different fluorescence emission wavelengths can be used in a single FISH experiment to map the locations of two or more genes. This method is called chromosome painting. Explain why this is an appropriate term.

> Figure 23.2 describes the technique of FISH. Why is it necessary to fix the cells (and the chromosomes inside of them) to the slides? What does it mean to fix them? Why is it necessary to denature the chromosomal DNA? From Figure 23.2: Sister chrom

> The cells from a person’s malignant tumor were subjected to in situ hybridization using a probe that recognizes a unique sequence on chromosome 14. The probe was detected only once in each of the cells. Explain this result, and speculate on its significa

> Describe the technique of in situ hybridization. Explain how it can be used to map genes.

> Explain what happened to the b allele that allowed gene conversion to occur.

> Discuss where protists are found in this newer organization of eukaryotic species.

> In an in situ hybridization experiment, what is the relationship between the base sequence of the probe DNA and the site on the chromosomal DNA where the probe binds?

> What is an STS? How are STSs generated experimentally? What are the uses of STSs? Explain how a microsatellite can be a polymorphic STS.

> Place the following stages of a physical mapping study in their most logical order: A. Clone large fragments of DNA to make a BAC library. B. Determine the DNA sequence of subclones from a cosmid library. C. Subclone BAC fragments to make a cosmid lib

> Take a look at question 3 in More Genetic TIPS. Let’s suppose a male is heterozygous for two polymorphic sequence-tagged sites. STS-1 exists in two sizes: 211 bp and 289 bp. STS-2 also exists in two sizes: 115 bp and 422 bp. A sample of

> In the Human Genome Project, researchers have collected linkage data from many crosses in which the male was heterozygous for molecular markers and many crosses where the female was heterozygous for the markers. The distance between the same two markers,

> An experimenter used primers that recognize nine different STSs to test their presence in five different BACs. The results are shown here. Draw a contig that maps the alignment of the five BACs. Alignment of STSS and BACS STSS 1 2 3 4 5 7 8 9 6 BACS

> A woman has had five children with two different men. This group of seven individuals is analyzed with regard to three different STSs: STS-1 is 146 bp and 122 bp; STS-2 is 102 bp and 88 bp; and STS-3 is 188 bp and 204 bp. The mother is homozygous for all

> Describe the molecular features of a BAC cloning vector. What is the primary advantage of a BAC vector over a plasmid or viral vector?

> Is each of the following a method used in linkage, cytogenetic, or physical mapping? A. Fluorescence in situ hybridization (FISH) B. Conducting two-factor crosses to compute map distances C. Chromosome walking D. Examination of polytene chromosomes i

> What is molecular pharming? Compared with the production of proteins by bacteria, why might it be advantageous?

> Describe the structure and location of a D-loop.

> Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999), “Analysis of telomere lengths in cloned sheep,” Nature 399, 316– 317] suggests that Dolly may have been genetically older than her actual age. As mammals age, the chromosomes in somat

> In the study of plants and animals, it is relatively common for researchers to identify a gene using molecular techniques without knowing the function of the gene. In the case of mice, the function of the gene can be investigated by making a gene knockou

> What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?

> List and briefly describe five methods for the introduction of cloned genes into plants.

> To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens and then grown in media containing kanamycin, carbenicillin, and plant growth hormones. Explain the purpose behind each of these three agents. What would happen if you lef

> In the procedure in Figure 22.1, why was it necessary to link the coding sequence for the A or B chains to the sequence for β-galactosidase? How were the A or B chains separated from β-galactosidase after the fusion pr

> In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other suffered from a disease known as thalassemia, which involves a defect in hemoglobin.

> The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown

> Let’s suppose an X-linked gene in mice exists as two alleles, which we will call B and b. X-chromosome inactivation, a process in which one X chromosome is turned off, occurs in the somatic cells of female mammals (see Chapter 5). Allele B encodes an mRN

> What is the purpose of a Northern blotting experiment? What types of information can it tell you about the transcription of a gene?

> Explain why a heteroduplex region may be produced after branch migration occurs.

> Bacillus thuringiensis makes toxins that kill insects. These toxins must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one strategy is to apply bacteria directly to leaves. However

> In Northern and Western blotting, what is the purpose of gel electrophoresis?

> Northern blotting depends on the phenomenon of the binding of a probe to mRNA. In this technique, explain why binding occurs.

> Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Letâ€&

> Let’s suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response element to a sequence of DNA that is 20 bp in length w

> A portion of the coding sequence of a cloned gene is shown here: 5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄ 3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄ This portion of the gene encodes a polypeptide with the amino acid sequence alanine–proline–aspartic acid–leucine–histid

> A sample of DNA was subjected to automated DNA sequencing and the output is shown here. What is the sequence of this DNA segment? T= Red C- Blue G- Black A- Green

> Several research studies are under way that involve the use of gene therapies to inhibit the growth of cancer cells. As discussed in Chapter 25, oncogenes are mutant genes that are overexpressed and cause cancer. New gene therapies are aimed at silencing

> Treatment of adenosine deaminase (ADA) deficiency is an example of ex vivo gene therapy. Why is this therapy called ex vivo? Can ex vivo gene therapy be used to treat all inherited diseases? Explain.

> Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental impairment. This disorder is inherited in an autosomal recessive manner, and the mutant allele is known to be a loss-of-function mutation. The same gene has

> Which of these repair systems is particularly valuable to plants?

> What is reproductive cloning? Are identical twins in humans considered to be clones? With regard to agricultural species, what are some potential advantages to reproductive cloning?

> Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how this is accomplished.

> Some vectors used in cloning experiments contain bacterial promoters that are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and express the gene in bacterial cells. These vectors are cal

> What is a DNA library? Do you think this name is appropriate?

> What is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.

> In your own words, describe the series of steps necessary to clone a gene.

> How does gene cloning produce many copies of a gene?

> Describe the important features of cloning vectors. Explain the purpose of selectable markers in cloning experiments.

> Table 21.3 describes the cleavage sites of five different restriction enzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The effi

> What is the advantage of genetic recombination, which is depicted in part (b)? From Figure 20.1: DO DO A da Two with Meiosis is parental genotype A crossover occurs between homologous chromatids. completed to yield 4 haploid cells. A B b Two with re

> DNA sequencing can help us to identify mutations within genes. The following data are derived from an experiment in which a normal gene and a mutant gene have been sequenced: Locate and describe the mutation G= Yellow A- Green T- Red C-

> What phase of PCR (exponential, linear, or stationary) is analyzed to quantitate the amount of DNA or RNA in a sample? Explain why this phase is chosen.

> What type of probe is used for real-time PCR? Explain how the level of fluorescence correlates with the level of PCR product.

> Starting with a sample of RNA that contains the mRNA for the β-globin gene, explain how you could create many copies of the β-globin cDNA using reverse transcriptase PCR.

> What is the functional significance of sticky ends in a cloning experiment? What type of bonding makes the ends sticky?

> A bacterium is exposed to a drug that inhibits the N protein. What would you expect to happen if the bacterium was later infected by phage λ? Would phage λ follow the lytic cycle, the lysogenic cycle, or neither? Explain your answer.

> Experimentally, when an E. coli bacterium already has a λ prophage integrated into its chromosome, another λ phage cannot usually infect the cell and establish the lysogenic or lytic cycle. Based on your understanding of the genetic regulation of the pha

> A researcher identified a mutation in PR of phage λ that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer.

> Richard Boyce and Paul Howard-Flanders conducted an experiment that provided biochemical evidence that thymine dimers are removed from DNA by a DNA repair system. In their studies, bacterial DNA was radiolabeled so the amount of radioactivity reflected t

> Gerald Rubin and Allan Spradling devised a method of introducing a transposon into Drosophila. This approach has been important for the transposon tagging of many Drosophila genes. The researchers began with a P element that had been cloned on a plasmid.

> What is a reactive oxygen species?

> Tumor-suppressor genes are normal human genes that prevent uncontrollable cell growth. Starting with a normal laboratory human cell line, describe how you could use transposon tagging to identify tumor-suppressor genes. (Note: When a TE hops into a tumor

> Compare and contrast anti-miRNA oligonucleotides, locked nucleic acids (LNAs), and antagomirs, which may eventually be used to treat certain forms of cancer. 

> As described in Chapter 21, the CRISPR-Cas system has been modified so it can be used as a gene mutagenesis tool (look ahead to Figure 21.13). Describe how the gene mutagenesis tool works, and explain how the natural CRISPR-Cas system is altered to produ

> Explain how the data of Fire and Mello suggested that doublestranded RNA is responsible for the silencing of mex-3 mRNA.

> In Experiment 17A, were Fire and Mello injecting pre-miRNA or pre-siRNA? Explain.

> In your own words, explain the term transposon tagging.

> As described in experimental question E2 and also in Chapter 21, the technique of Northern blotting can be used to detect the level of transcription of a specific RNA. Draw the results you would expect from a Northern blot if bacteria were grown in media

> A protein called trypsin, which plays a role in digestion, is made by pancreatic cells and secreted from those cells. Starting with a sample of pancreatic cells, a researcher modified the gene that encodes trypsin by mutating the ER signal sequence so it

> Look back at Figure 16.7. If you crossed an F2 offspring to a homozygous B-I B-I plant, what phenotypic results would you expect for the F3 offspring? From Figure 16.7: Strain A: B' B' (This strain is homozygous for the weak allele. The ' symbol ind

> Let’s suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs? What possible side effects might your drugs cause?

> Which of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why

> A research study indicated that an agent in cigarette smoke caused the silencing of a tumor-suppressor gene called p53. However, using sequencing, no mutation was found in the DNA sequence for this gene. Give two possible explanations for these results.

> 5-Azocytidine is an inhibitor of DNA methyltransferase. If this drug were fed to female mice during pregnancy, explain how you think it would affect the coat color of offspring carrying the Avy allele.

> In the experiments described in Figure 16.8, explain the relationship between coat color and DNA methylation. How is coat color related to the diet of the mother? From Figure 16.8: Promoter within Transposable element transposable Normal promoter el

> A gene, which we will call gene C, can be epigenetically modified in such a way that its expression in some cells is permanently silenced. Describe how you could conduct cell-fusion experiments to determine if a cis- or a trans-epigenetic mechanism is re

> Chapter 21 describes a blotting method known as Northern blotting, in which a short segment of cloned DNA is used as a probe to detect RNA that is transcribed from a particular gene. The DNA probe, which is labeled, is complementary to the RNA that the r

> As described in Chapter 21, an electrophoretic mobility shift assay (EMSA) can be used to determine if a protein binds to a segment of DNA. When a segment of DNA is bound by a protein, its mobility will be retarded, and the DNA band will appear higher in

> The work of McClintock showed that the presence of a transposon can create a mutable site or locus that is subject to frequent chromosome breakage. Why do you think a transposon creates a mutable site? If chromosome breakage occurs, do you think the tran

> You will need to understand question 3 in More Genetic TIPS before answering this question. A gene that is normally expressed in pancreatic cells was cloned and then subjected to promoter bashing. As shown here, four regions, labeled A–

> You will need to understand question 3 in More Genetic TIPS before answering this question. A muscle-specific gene was cloned and then subjected to promoter bashing. As shown here, six regions, labeled A–F, were deleted, and then the DN

> Restriction enzymes, described in Chapter 21, are enzymes that recognize a particular DNA sequence and cleave the DNA (along the DNA backbone) at that site. The restriction enzyme known as NotI recognizes the sequence 5′â€&#

> When DNA replication occurs over an apurinic site, what is the probability that a mutation will occur?

> Researchers can isolate a sample of cells, such as skin fibroblasts, and grow them in the laboratory. This procedure is called a cell culture. A cell culture can be exposed to a sample of DNA. If the cells are treated with agents that make their membrane

> Briefly describe the method of chromatin immunoprecipitation sequencing (ChIP-Seq). How is it used to determine nucleosome positions within a genome?

> Let’s suppose you have isolated a mutant strain of E. coli in which the lac operon is constitutively expressed. To understand the nature of this defect, you create a merozygote in which the mutant strain contains an F′

> A mutant strain has a defective lac operator site that results in the constitutive expression of the lac operon. Outline an experiment you would carry out to demonstrate that the operator site must be physically adjacent to the genes that it influences.

> Explain how the data shown in Figure 14.9 indicate that two operator sites are necessary for repression of the lac operon. What would the results have been if all three operator sites were required for the binding of lac repressor? From Figure 14.9:

> An absentminded researcher follows the protocol described in Figure 14.7 and (at the end of the experiment) does not observe any yellow color in any of the tubes. Yikes! Which of the following mistakes could account for this observation? A. Forgot to so

> This question combines your knowledge of bacterial conjugation (described in Chapter 7) and the genetic regulation that directs the phage λ reproductive cycles. When researchers mix donor Hfr strains with recipient F– bacteria that are lysogenic for phag

> Briefly explain how McClintock determined that Ds was occasionally moving from one chromosomal location to another. Discuss the type of data she examined to arrive at this conclusion.

> During an Ames test, bacteria were exposed to a potential mutagen. Also, as a control, another sample of bacteria was not exposed to the mutagen. In both cases, 10 million bacteria were plated and the following results were obtained: No mutagen: 17 colo

> How would you modify the Ames test to evaluate physical mutagens? Would it be necessary to add the rat liver extract? Explain why or why not.