Question: Gerald Rubin and Allan Spradling devised a
Gerald Rubin and Allan Spradling devised a method of introducing a transposon into Drosophila. This approach has been important for the transposon tagging of many Drosophila genes. The researchers began with a P element that had been cloned on a plasmid. (Note: Methods of cloning are described in Chapter 21.) Using cloning methods, they inserted the wild-type allele for the rosy gene into the P element in this plasmid. The recessive allele, rosy, results in a rosy eye color, while the wild-type allele, rosy+, produces red eyes. The plasmid also had an intact transposase gene. The cloned DNA is shown to the right. 
Rubin and Spradling used a micropipette to inject this DNA into regions of embryos that would later become reproductive cells. These embryos were originally homozygous for the recessive rosy allele. However, the P element carrying the rosy+ allele could “hop†out of the plasmid and into a chromosome of the cells that were destined to become germ cells (i.e., sperm or egg cells). After the embryos had matured to adults, the flies were then mated to flies that were homozygous for the recessive rosy allele. If offspring inherited a chromosome carrying the P element with the rosy+ gene, those offspring would have red eyes. Therefore, the phenotype of red eyes provided a way to identify offspring that had a P element insertion. Now here is the question. Let’s suppose you were interested in identifying genes that play a role in wing development. Outline the experimental steps you would follow, using the plasmid with the P element containing the rosy+ gene, as a way to transposon tag genes that play a role in wing development. (Note: You should assume that the inactivation of a gene involved in wing development would cause an abnormality in wing shape. Also keep in mind that most P element insertions inactivate genes and may be inherited in a recessive manner.)
Transcribed Image Text:
rosy -P element
> In the Human Genome Project, researchers have collected linkage data from many crosses in which the male was heterozygous for molecular markers and many crosses where the female was heterozygous for the markers. The distance between the same two markers,
> An experimenter used primers that recognize nine different STSs to test their presence in five different BACs. The results are shown here. Draw a contig that maps the alignment of the five BACs. Alignment of STSS and BACS STSS 1 2 3 4 5 7 8 9 6 BACS
> A woman has had five children with two different men. This group of seven individuals is analyzed with regard to three different STSs: STS-1 is 146 bp and 122 bp; STS-2 is 102 bp and 88 bp; and STS-3 is 188 bp and 204 bp. The mother is homozygous for all
> Describe the molecular features of a BAC cloning vector. What is the primary advantage of a BAC vector over a plasmid or viral vector?
> Is each of the following a method used in linkage, cytogenetic, or physical mapping? A. Fluorescence in situ hybridization (FISH) B. Conducting two-factor crosses to compute map distances C. Chromosome walking D. Examination of polytene chromosomes i
> What is molecular pharming? Compared with the production of proteins by bacteria, why might it be advantageous?
> Describe the structure and location of a D-loop.
> Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999), “Analysis of telomere lengths in cloned sheep,” Nature 399, 316– 317] suggests that Dolly may have been genetically older than her actual age. As mammals age, the chromosomes in somat
> In the study of plants and animals, it is relatively common for researchers to identify a gene using molecular techniques without knowing the function of the gene. In the case of mice, the function of the gene can be investigated by making a gene knockou
> What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?
> List and briefly describe five methods for the introduction of cloned genes into plants.
> To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens and then grown in media containing kanamycin, carbenicillin, and plant growth hormones. Explain the purpose behind each of these three agents. What would happen if you lef
> In the procedure in Figure 22.1, why was it necessary to link the coding sequence for the A or B chains to the sequence for β-galactosidase? How were the A or B chains separated from β-galactosidase after the fusion pr
> In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other suffered from a disease known as thalassemia, which involves a defect in hemoglobin.
> The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown
> Let’s suppose an X-linked gene in mice exists as two alleles, which we will call B and b. X-chromosome inactivation, a process in which one X chromosome is turned off, occurs in the somatic cells of female mammals (see Chapter 5). Allele B encodes an mRN
> What is the purpose of a Northern blotting experiment? What types of information can it tell you about the transcription of a gene?
> Explain why a heteroduplex region may be produced after branch migration occurs.
> Bacillus thuringiensis makes toxins that kill insects. These toxins must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one strategy is to apply bacteria directly to leaves. However
> In Northern and Western blotting, what is the purpose of gel electrophoresis?
> Northern blotting depends on the phenomenon of the binding of a probe to mRNA. In this technique, explain why binding occurs.
> Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Letâ€&
> Let’s suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response element to a sequence of DNA that is 20 bp in length w
> A portion of the coding sequence of a cloned gene is shown here: 5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄ 3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄ This portion of the gene encodes a polypeptide with the amino acid sequence alanine–proline–aspartic acid–leucine–histid
> A sample of DNA was subjected to automated DNA sequencing and the output is shown here. What is the sequence of this DNA segment? T= Red C- Blue G- Black A- Green
> Several research studies are under way that involve the use of gene therapies to inhibit the growth of cancer cells. As discussed in Chapter 25, oncogenes are mutant genes that are overexpressed and cause cancer. New gene therapies are aimed at silencing
> Treatment of adenosine deaminase (ADA) deficiency is an example of ex vivo gene therapy. Why is this therapy called ex vivo? Can ex vivo gene therapy be used to treat all inherited diseases? Explain.
> Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental impairment. This disorder is inherited in an autosomal recessive manner, and the mutant allele is known to be a loss-of-function mutation. The same gene has
> Which of these repair systems is particularly valuable to plants?
> What is reproductive cloning? Are identical twins in humans considered to be clones? With regard to agricultural species, what are some potential advantages to reproductive cloning?
> Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how this is accomplished.
> Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the dideoxy method or in sitedirected mutagenesis?
> Some vectors used in cloning experiments contain bacterial promoters that are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and express the gene in bacterial cells. These vectors are cal
> What is a DNA library? Do you think this name is appropriate?
> What is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.
> In your own words, describe the series of steps necessary to clone a gene.
> How does gene cloning produce many copies of a gene?
> Describe the important features of cloning vectors. Explain the purpose of selectable markers in cloning experiments.
> Table 21.3 describes the cleavage sites of five different restriction enzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The effi
> What is the advantage of genetic recombination, which is depicted in part (b)? From Figure 20.1: DO DO A da Two with Meiosis is parental genotype A crossover occurs between homologous chromatids. completed to yield 4 haploid cells. A B b Two with re
> DNA sequencing can help us to identify mutations within genes. The following data are derived from an experiment in which a normal gene and a mutant gene have been sequenced: Locate and describe the mutation G= Yellow A- Green T- Red C-
> What phase of PCR (exponential, linear, or stationary) is analyzed to quantitate the amount of DNA or RNA in a sample? Explain why this phase is chosen.
> What type of probe is used for real-time PCR? Explain how the level of fluorescence correlates with the level of PCR product.
> Starting with a sample of RNA that contains the mRNA for the β-globin gene, explain how you could create many copies of the β-globin cDNA using reverse transcriptase PCR.
> What is the functional significance of sticky ends in a cloning experiment? What type of bonding makes the ends sticky?
> A bacterium is exposed to a drug that inhibits the N protein. What would you expect to happen if the bacterium was later infected by phage λ? Would phage λ follow the lytic cycle, the lysogenic cycle, or neither? Explain your answer.
> Experimentally, when an E. coli bacterium already has a λ prophage integrated into its chromosome, another λ phage cannot usually infect the cell and establish the lysogenic or lytic cycle. Based on your understanding of the genetic regulation of the pha
> A researcher identified a mutation in PR of phage λ that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer.
> Richard Boyce and Paul Howard-Flanders conducted an experiment that provided biochemical evidence that thymine dimers are removed from DNA by a DNA repair system. In their studies, bacterial DNA was radiolabeled so the amount of radioactivity reflected t
> What is a reactive oxygen species?
> Tumor-suppressor genes are normal human genes that prevent uncontrollable cell growth. Starting with a normal laboratory human cell line, describe how you could use transposon tagging to identify tumor-suppressor genes. (Note: When a TE hops into a tumor
> Compare and contrast anti-miRNA oligonucleotides, locked nucleic acids (LNAs), and antagomirs, which may eventually be used to treat certain forms of cancer.
> As described in Chapter 21, the CRISPR-Cas system has been modified so it can be used as a gene mutagenesis tool (look ahead to Figure 21.13). Describe how the gene mutagenesis tool works, and explain how the natural CRISPR-Cas system is altered to produ
> Explain how the data of Fire and Mello suggested that doublestranded RNA is responsible for the silencing of mex-3 mRNA.
> In Experiment 17A, were Fire and Mello injecting pre-miRNA or pre-siRNA? Explain.
> In your own words, explain the term transposon tagging.
> As described in experimental question E2 and also in Chapter 21, the technique of Northern blotting can be used to detect the level of transcription of a specific RNA. Draw the results you would expect from a Northern blot if bacteria were grown in media
> A protein called trypsin, which plays a role in digestion, is made by pancreatic cells and secreted from those cells. Starting with a sample of pancreatic cells, a researcher modified the gene that encodes trypsin by mutating the ER signal sequence so it
> Look back at Figure 16.7. If you crossed an F2 offspring to a homozygous B-I B-I plant, what phenotypic results would you expect for the F3 offspring? From Figure 16.7: Strain A: B' B' (This strain is homozygous for the weak allele. The ' symbol ind
> Let’s suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs? What possible side effects might your drugs cause?
> Which of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why
> A research study indicated that an agent in cigarette smoke caused the silencing of a tumor-suppressor gene called p53. However, using sequencing, no mutation was found in the DNA sequence for this gene. Give two possible explanations for these results.
> 5-Azocytidine is an inhibitor of DNA methyltransferase. If this drug were fed to female mice during pregnancy, explain how you think it would affect the coat color of offspring carrying the Avy allele.
> In the experiments described in Figure 16.8, explain the relationship between coat color and DNA methylation. How is coat color related to the diet of the mother? From Figure 16.8: Promoter within Transposable element transposable Normal promoter el
> A gene, which we will call gene C, can be epigenetically modified in such a way that its expression in some cells is permanently silenced. Describe how you could conduct cell-fusion experiments to determine if a cis- or a trans-epigenetic mechanism is re
> Chapter 21 describes a blotting method known as Northern blotting, in which a short segment of cloned DNA is used as a probe to detect RNA that is transcribed from a particular gene. The DNA probe, which is labeled, is complementary to the RNA that the r
> As described in Chapter 21, an electrophoretic mobility shift assay (EMSA) can be used to determine if a protein binds to a segment of DNA. When a segment of DNA is bound by a protein, its mobility will be retarded, and the DNA band will appear higher in
> The work of McClintock showed that the presence of a transposon can create a mutable site or locus that is subject to frequent chromosome breakage. Why do you think a transposon creates a mutable site? If chromosome breakage occurs, do you think the tran
> You will need to understand question 3 in More Genetic TIPS before answering this question. A gene that is normally expressed in pancreatic cells was cloned and then subjected to promoter bashing. As shown here, four regions, labeled A–
> You will need to understand question 3 in More Genetic TIPS before answering this question. A muscle-specific gene was cloned and then subjected to promoter bashing. As shown here, six regions, labeled A–F, were deleted, and then the DN
> Restriction enzymes, described in Chapter 21, are enzymes that recognize a particular DNA sequence and cleave the DNA (along the DNA backbone) at that site. The restriction enzyme known as NotI recognizes the sequence 5′â€&#
> When DNA replication occurs over an apurinic site, what is the probability that a mutation will occur?
> Researchers can isolate a sample of cells, such as skin fibroblasts, and grow them in the laboratory. This procedure is called a cell culture. A cell culture can be exposed to a sample of DNA. If the cells are treated with agents that make their membrane
> Briefly describe the method of chromatin immunoprecipitation sequencing (ChIP-Seq). How is it used to determine nucleosome positions within a genome?
> Let’s suppose you have isolated a mutant strain of E. coli in which the lac operon is constitutively expressed. To understand the nature of this defect, you create a merozygote in which the mutant strain contains an F′
> A mutant strain has a defective lac operator site that results in the constitutive expression of the lac operon. Outline an experiment you would carry out to demonstrate that the operator site must be physically adjacent to the genes that it influences.
> Explain how the data shown in Figure 14.9 indicate that two operator sites are necessary for repression of the lac operon. What would the results have been if all three operator sites were required for the binding of lac repressor? From Figure 14.9:
> An absentminded researcher follows the protocol described in Figure 14.7 and (at the end of the experiment) does not observe any yellow color in any of the tubes. Yikes! Which of the following mistakes could account for this observation? A. Forgot to so
> This question combines your knowledge of bacterial conjugation (described in Chapter 7) and the genetic regulation that directs the phage λ reproductive cycles. When researchers mix donor Hfr strains with recipient F– bacteria that are lysogenic for phag
> Briefly explain how McClintock determined that Ds was occasionally moving from one chromosomal location to another. Discuss the type of data she examined to arrive at this conclusion.
> During an Ames test, bacteria were exposed to a potential mutagen. Also, as a control, another sample of bacteria was not exposed to the mutagen. In both cases, 10 million bacteria were plated and the following results were obtained: No mutagen: 17 colo
> How would you modify the Ames test to evaluate physical mutagens? Would it be necessary to add the rat liver extract? Explain why or why not.
> Can this trait be passed to offspring?
> From an experimental point of view, is it better to use haploid or diploid organisms for mutagen testing? Consider the Ames test when preparing your answer.
> Outline how you would use the technique of replica plating to show that antibiotic resistance is due to random mutations.
> Explain how the technique of replica plating supports the random mutation theory but conflicts with the physiological adaptation hypothesis.
> Some drugs that inhibit HIV proliferation are inhibitors of HIV protease. Explain how these drugs would help to stop the spread of HIV.
> Certain drugs to combat human viral diseases affect spike glycoproteins in the viral envelope. Discuss how you think such drugs may prevent viral infection.
> Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea that the RNA of TMV is responsible for the traits of the
> What is a reconstituted virus?
> What is heterosis? Discuss whether it is caused by a single gene or several genes. Discuss the two major hypotheses proposed to explain heterosis. Which do you think is more likely to be correct?
> From a biological viewpoint, speculate as to why many traits seem to fit a normal distribution. Students with a strong background in math and statistics may want to explain how a normal distribution is generated, and what it means. Can you think of biolo
> Discuss why heritability is an important phenomenon in agriculture.
> Has the DNA sequence of the eye color gene been changed in part (b) compared with part (a)? How do we explain the phenotypic difference? From Figure 19.3: (a) Normal eye (b) Variegated eye
> Most new mutations are detrimental, yet rare beneficial mutations can be adaptive. With regard to the fate of new mutations, discuss whether you think it is more important for natural selection to select against detrimental alleles or to select in favor
> Discuss the role of mutation in the origin of genetic polymorphisms. Suppose that a genetic polymorphism involves two alleles at frequencies of 0.45 and 0.55. Describe three different scenarios to explain these observed allele frequencies. You can propos
> Discuss examples of positive and negative assortative mating in natural populations, human populations, and agriculturally important species.
> At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence would be altered.
> It seems that developmental genetics boils down to a complex network of gene regulation. Try to draw a structure of this network for Drosophila. How many genes do you think are necessary to complete the developmental network for the fruit fly? How many g
> Compare and contrast the experimental advantages and disadvantages of Drosophila, C. elegans, mammals, and Arabidopsis.
