Homologous in molecular biology is defined as the two genes that have been derived from the common ancestor. These two genes have an almost similar sequence of nitrogenous bases (A, G, C, U) in their DNA. It can also be taken in terms of homologous chromosomes which are defined as the paired chromosomes. These chromosomes have the same location of the centromere, have the same sequence of genes and the same loci.
The length of these chromosomes is also the same but the alleles present on the loci may be different. The genetic material of a human is composed of 23 pair of homologous chromosomes out of which 22 pairs are autosomal and the 1 pair which is sex chromosome may be homologous in case of XX (female) or heterologous in case of XY (male).
In 1995, Edward Lanphier founded Sangamo Biosciences for the purpose of
The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA
In this example, what is the underlying cause of nonallelic homologous
Explain why these homologous chromosomes can synapse only if an inversion loop
If homologous and site-specific recombination could not occur, what
Make a list of the similarities and differences among homologous recombination,
With regard to the repair of double-strand breaks, what
Why are the homologous regions of the X and Y chromosome important
Most bats eat insects or fruit. Vampire bats, however,
Three common ways to repair changes in DNA structure are nucleotide excision
