Q: A woman who is heterozygous, Bb, has brown eyes;
A woman who is heterozygous, Bb, has brown eyes; B (brown) is the dominant allele, and b (blue) is recessive. One of her eyes, however, has a patch of blue color. Give three different explanations for...
See AnswerQ: The compound known as nitrous acid is a reactive chemical that replaces
The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil...
See AnswerQ: One way that bacterial cells regulate DNA replication is through GATC methylation
One way that bacterial cells regulate DNA replication is through GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semiconse...
See AnswerQ: The chromosome of E. coli contains 4.6 million bp
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during...
See AnswerQ: Here are two strands of DNA. —————————————— DNA polymerase→
Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the dir...
See AnswerQ: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC
A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this...
See AnswerQ: List and briefly describe the three types of functionally important sequences within
List and briefly describe the three types of functionally important sequences within bacterial origins of replication.
See AnswerQ: Why does independent assortment promote genetic variation?
Why does independent assortment promote genetic variation?
See AnswerQ: Explain the central dogma of genetics at the molecular level
Explain the central dogma of genetics at the molecular level
See AnswerQ: At the molecular level, describe how σ factor recognizes a bacterial
At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.
See Answer
