Questions from Genetics

Q: Let’s suppose a DNA mutation changes the consensus sequence at the −

Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit...

Q: What is the complementarity rule that governs the synthesis of an RNA

What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the seq...

Q: Describe the movement of the open complex along the DNA.

Describe the movement of the open complex along the DNA.

Q: Describe what happens to the chemical bonding interactions when transcriptional termination occurs

Describe what happens to the chemical bonding interactions when transcriptional termination occurs. Be specific about the type of chemical bonding.

Q: Discuss the differences between ρ-dependent and ρ-independent termination

Discuss the differences between ρ-dependent and ρ-independent termination.

Q: In Chapter 11, we discussed the function of DNA helicase,

In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.

Q: Discuss the similarities and differences between RNA polymerase (described in this

Discuss the similarities and differences between RNA polymerase (described in this chapter) and DNA polymerase (described in Chapter 11).

Q: Mutations that occur at the end of a gene may alter the

Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What type...

Q: If a parent plant is Ttyy, how many different types of

If a parent plant is Ttyy, how many different types of gametes can it make?

Q: If the following RNA polymerases were missing from a eukaryotic cell,

If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III