To identify the following types of genetic occurrences, would a computer program use sequence recognition, pattern recognition, or both? A. Whether a segment of Drosophila DNA contains a P element (which is a specific type of transposable element) B. Whether a segment of DNA contains a stop codon C. In a comparison of two DNA segments, whether there is an inversion in one segment compared with the other segment D. Whether a long segment of bacterial DNA contains one or more genes
> Ben, who has health insurance provided through his employer, has an appointment with his physician for an annual exam. Ben pays a $25 co-pay at the doctor’s office. Ben tells Sheila it cost him $25 for the appointment. Sheila responds, “Oh no, Ben, you p
> Debbie has owned her home for several years and has been paying her mortgage on time every month. She is building equity in her home, which can then be used for what type of personal loan?
> Banks offer a wide variety of business loans. Explain why banks try to seek a balance between short-term and long-term loans in their loan portfolio. What are the advantages and disadvantages of offering short-term loans versus long-term loans?
> Explain the trade-offs banks face when they consider holding high-yield securities.
> Demand deposit and NOW accounts are commonly referred to as:
> Not all financial assets are the right vehicle for everyone. Give an example of someone for whom a certificate of deposit would be useful. Also give an example of someone for whom a certificate of deposit would be a bad choice.
> Financial innovations can have dramatic effects. Explain how and why NOW accounts came about and the impact they have had on financial markets.
> Which is currently the largest liability of banks?
> Banks usually hold a very small percentage of their assets in the form of cash. Recently, however, banks have been holding on to larger amounts of cash. What impact does this have on the other categories of a bank’s balance sheet?
> Hank is confused as to what banks do. He reads that banks “transform assets,” but he has no idea what that means. How would you explain asset transformation to Hank?
> What did Karl Marx consider to be the main economic problem that would ultimately cause the collapse of capitalism?
> Elise is a recent college graduate with student loans on which her parents have cosigned. If Elise is looking to purchase low-cost life insurance to ensure her parents will not have to repay her student loans if she dies unexpectedly, arguably the best l
> Changes to the structure of the Fed during the Great Depression included:
> Explain why familial breast cancer shows a dominant pattern of inheritance in a pedigree even though it is recessive at the cellular level.
> What is a checkpoint?
> What feature(s) of this pedigree indicate(s) recessive inheritance? I-1 1-2 II-8 II-9 Il-11 Il-1 Il-2 II-3 II-4 II-5 II-6 II-7 п-10 III -I III-2 III-3 III-4 II-5 III-6 III-7 III-8 II-9 III-10 III-11 Tay Sachs disease Unaffected heterozygote (carrier)
> What is the main advantage of using YACs, BACs, and PACs?
> What is a contig?
> What causes microsatellites to be polymorphic?
> Why does the probe bind to a specific site on a chromosome?
> What is a genetic map?
> Are hematopoietic stem cells unipotent, multipotent, or pluripotent?
> Explain why stem cells are not depleted during the life of an organism.
> What is the difference between a paralog and an ortholog?
> Is Carbon Copy a transgenic animal?
> In the protocol, why is the nucleus of the oocyte removed?
> Why is a β-lactoglobulin promoter used?
> What is the difference between a gene knockout and a gene knockin?
> What is the purpose of using CNBr in this experiment?
> What is the purpose of using a secondary antibody?
> How is the sgRNA different from certain components of the bacterial defense system described in Chapter 17?
> Describe three possible uses of site-directed mutagenesis.
> What needs to happen so the reporter molecule can emit fluorescence that is not quenched?
> After four cycles of PCR, which type of PCR product predominates? Explain why.
> What is horizontal gene transfer?
> What is an advantage of making a cDNA library rather than a genomic library?
> Explain the meaning of the name reverse transcriptase.
> Explain the role of the gene that is the selectable marker gene in this experiment.
> Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments together?
> What is the purpose of the rat liver extract in this procedure?
> In people, what is a common cause of thymine dimer formation and in what cell type(s) would it be most likely to occur?
> Does 5-bromouracil cause a transition or a transversion?
> Explain how tandem mass spectroscopy is used to determine the sequence of a peptide. Once a peptide sequence is known, how is this information used to determine the sequence of the entire protein?
> Can two-dimensional gel electrophoresis be used as a purification technique? Explain.
> In the procedure called RNA sequencing (RNA-Seq), what type of molecule is actually sequenced?
> Refer to question 3 in More Genetic TIPS before answering this question. Based on the multiple-sequence alignment in Figure 24.10, what is/are the most probable time(s) that mutations occurred in the human globin gene family to produce the following amin
> Take a look at the multiple-sequence alignment in Figure 24.10 of the globin polypeptides, focusing on amino acids 101 to 148. A. Which of these amino acids are likely to be most important for globin structure and function? Explain why. B. Which are li
> What is the function of reverse transcriptase?
> The goal of many computer programs is to identify sequence elements within a long segment of DNA. What is a sequence element? Give two examples. How is the specific sequence of a sequence element determined? In other words, is it determined by the comput
> In this chapter, we considered a computer program that translates a DNA sequence into a polypeptide sequence. Instead of running this program, a researcher could simply look the codons up in a genetic code table and determine the sequence by hand. What a
> With regard to DNA microarrays, answer the following questions: A. What is attached to the slide? Be specific about the number of spots, the lengths of DNA fragments, and the origin of the DNA fragments. B. What is hybridized to the microarray? C. How
> Explain how DNA microarrays are used in molecular profiling of cancerous tumors.
> The codon change (Gly-12 to Val-12) in human rasH that converts it to oncogenic rasH has been associated with many types of cancers. For this reason, researchers would like to develop drugs to inhibit oncogenic rasH. Based on your understanding of the Ra
> Discuss ways to distinguish whether a particular form of cancer involves an inherited predisposition or is due strictly to (postzygotic) somatic mutations. In your answer, consider that only one mutation may be inherited, but the cancer might develop onl
> An experimental assay for the blood-clotting protein called factor IX is available. A blood sample was obtained from each individual in the following pedigree. The amount of factor IX protein, shown within each symbol on the pedigree, is expressed as a p
> Chapter 21 describes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detected by an antibody that specifically recognizes a segm
> A particular disease is found in a group of South American Indians. During the 1920s, many of these people migrated to Central America. In the Central American group, the disease is never found. Discuss whether or not you think the disease has a genetic
> Which of these mechanisms causes the TE to increase in number?
> What is meant by the term genetic testing? How do testing at the protein level and testing at the DNA level differ? Describe five different techniques used in genetic testing.
> Section 25.1 discussed the types of experimental observations that suggest a disease is inherited. Which of these observations do you find the least convincing? Which do you find the most convincing? Explain your answer.
> Which of the following experimental observations suggest that a disease has a genetic basis? A. The frequency of the disease is less likely in relatives that live apart compared with relatives that live together. B. The frequency of the disease is unus
> Contigs are often made using BAC or cosmid vectors. What are the advantages and disadvantages of these two types of vectors? Which type of contig would you make first, a BAC or cosmid contig? Explain.
> What is a contig? Explain how you would determine that two clones in a contig are overlapping.
> A researcher is interested in a gene found on human chromosome 21. Describe the expected results of a FISH experiment using a probe that is complementary to this gene. How many spots would you see if the probe was used on a sample from an individual with
> Explain how DNA probes with different fluorescence emission wavelengths can be used in a single FISH experiment to map the locations of two or more genes. This method is called chromosome painting. Explain why this is an appropriate term.
> Figure 23.2 describes the technique of FISH. Why is it necessary to fix the cells (and the chromosomes inside of them) to the slides? What does it mean to fix them? Why is it necessary to denature the chromosomal DNA? From Figure 23.2: Sister chrom
> The cells from a person’s malignant tumor were subjected to in situ hybridization using a probe that recognizes a unique sequence on chromosome 14. The probe was detected only once in each of the cells. Explain this result, and speculate on its significa
> Describe the technique of in situ hybridization. Explain how it can be used to map genes.
> Explain what happened to the b allele that allowed gene conversion to occur.
> Discuss where protists are found in this newer organization of eukaryotic species.
> In an in situ hybridization experiment, what is the relationship between the base sequence of the probe DNA and the site on the chromosomal DNA where the probe binds?
> What is an STS? How are STSs generated experimentally? What are the uses of STSs? Explain how a microsatellite can be a polymorphic STS.
> Place the following stages of a physical mapping study in their most logical order: A. Clone large fragments of DNA to make a BAC library. B. Determine the DNA sequence of subclones from a cosmid library. C. Subclone BAC fragments to make a cosmid lib
> Take a look at question 3 in More Genetic TIPS. Let’s suppose a male is heterozygous for two polymorphic sequence-tagged sites. STS-1 exists in two sizes: 211 bp and 289 bp. STS-2 also exists in two sizes: 115 bp and 422 bp. A sample of
> In the Human Genome Project, researchers have collected linkage data from many crosses in which the male was heterozygous for molecular markers and many crosses where the female was heterozygous for the markers. The distance between the same two markers,
> An experimenter used primers that recognize nine different STSs to test their presence in five different BACs. The results are shown here. Draw a contig that maps the alignment of the five BACs. Alignment of STSS and BACS STSS 1 2 3 4 5 7 8 9 6 BACS
> A woman has had five children with two different men. This group of seven individuals is analyzed with regard to three different STSs: STS-1 is 146 bp and 122 bp; STS-2 is 102 bp and 88 bp; and STS-3 is 188 bp and 204 bp. The mother is homozygous for all
> Describe the molecular features of a BAC cloning vector. What is the primary advantage of a BAC vector over a plasmid or viral vector?
> Is each of the following a method used in linkage, cytogenetic, or physical mapping? A. Fluorescence in situ hybridization (FISH) B. Conducting two-factor crosses to compute map distances C. Chromosome walking D. Examination of polytene chromosomes i
> What is molecular pharming? Compared with the production of proteins by bacteria, why might it be advantageous?
> Describe the structure and location of a D-loop.
> Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999), “Analysis of telomere lengths in cloned sheep,” Nature 399, 316– 317] suggests that Dolly may have been genetically older than her actual age. As mammals age, the chromosomes in somat
> In the study of plants and animals, it is relatively common for researchers to identify a gene using molecular techniques without knowing the function of the gene. In the case of mice, the function of the gene can be investigated by making a gene knockou
> What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?
> List and briefly describe five methods for the introduction of cloned genes into plants.
> To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens and then grown in media containing kanamycin, carbenicillin, and plant growth hormones. Explain the purpose behind each of these three agents. What would happen if you lef
> In the procedure in Figure 22.1, why was it necessary to link the coding sequence for the A or B chains to the sequence for β-galactosidase? How were the A or B chains separated from β-galactosidase after the fusion pr
> In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other suffered from a disease known as thalassemia, which involves a defect in hemoglobin.
> The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown
> Let’s suppose an X-linked gene in mice exists as two alleles, which we will call B and b. X-chromosome inactivation, a process in which one X chromosome is turned off, occurs in the somatic cells of female mammals (see Chapter 5). Allele B encodes an mRN
> What is the purpose of a Northern blotting experiment? What types of information can it tell you about the transcription of a gene?
> Explain why a heteroduplex region may be produced after branch migration occurs.
> Bacillus thuringiensis makes toxins that kill insects. These toxins must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one strategy is to apply bacteria directly to leaves. However
> In Northern and Western blotting, what is the purpose of gel electrophoresis?
> Northern blotting depends on the phenomenon of the binding of a probe to mRNA. In this technique, explain why binding occurs.
> Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequence affect the function of a protein. Letâ€&
> Let’s suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response element to a sequence of DNA that is 20 bp in length w
> A portion of the coding sequence of a cloned gene is shown here: 5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄ 3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄ This portion of the gene encodes a polypeptide with the amino acid sequence alanine–proline–aspartic acid–leucine–histid
> A sample of DNA was subjected to automated DNA sequencing and the output is shown here. What is the sequence of this DNA segment? T= Red C- Blue G- Black A- Green
> Several research studies are under way that involve the use of gene therapies to inhibit the growth of cancer cells. As discussed in Chapter 25, oncogenes are mutant genes that are overexpressed and cause cancer. New gene therapies are aimed at silencing