Question: Here are data for height and weight

> What type of bonding interaction causes stem-loops to form?

> Figure 25.1 illustrates albinism in two different species. Describe two other genetic disorders found in both humans and animals. From Figure 25.1:

> We often speak of diseases such as phenylketonuria (PKU) and achondroplasia as having a genetic basis. Explain whether the following statements are accurate with regard to the genetic basis of any human disease (not just PKU and achondroplasia). A. An i

> In general, why do changes in chromosome structure or number tend to affect an individual’s phenotype? Explain why some changes in chromosome structure, such as reciprocal translocations, do not.

> Many genetic disorders exhibit locus heterogeneity. Define and give two examples of locus heterogeneity. How does locus heterogeneity confound a pedigree analysis?

> When the DNA of a human cell becomes damaged, the p53 gene is activated. What is the general function of the p53 protein? Is it an enzyme, transcription factor, cell-cycle protein, or something else? Describe three ways in which the synthesis of the p53

> With regard to cancer cells, which of the following statements are true? A. Cancer cells are clonal, which means they are derived from a single mutant cell. B. To become cancerous, cells usually accumulate multiple genetic changes that eventually resul

> A p53 knockout mouse in which both copies of p53 are defective has been produced by researchers. This type of mouse appears normal at birth. However, it is highly sensitive to UV light. Based on your knowledge of p53, explain the normal appearance at bir

> The rb gene encodes a protein that inhibits E2F, a transcription factor that activates several genes involved in cell division. Mutations in rb are associated with certain forms of cancer, such as retinoblastoma. Under each of the following conditions, w

> Relatively few inherited forms of cancer involve the inheritance of mutant oncogenes. Instead, most inherited forms of cancer are defects in tumor-suppressor genes. Give two or more reasons why inherited forms of cancer seldom involve activated oncogenes

> A genetic predisposition to developing cancer is usually inherited as a dominant trait. At the level of cellular function, are the alleles involved actually dominant? Explain why some individuals who have inherited these dominant alleles do not develop c

> How does tryptophan affect the function of trp repressor?

> A genetic predisposition to developing cancer is usually inherited as a dominant trait. At the level of cellular function, are the alleles involved actually dominant? Explain why some individuals who have inherited these dominant alleles do not develop c

> What is a retroviral oncogene? Is it necessary for viral infection and proliferation? How have retroviruses acquired oncogenes?

> What is a proto-oncogene? What are the typical functions of proteins encoded by proto-oncogenes? At the level of protein function, what are the general ways that proto-oncogenes can be converted to oncogenes?

> What is the difference between an oncogene and a tumor-suppressor gene? Give two examples of each type of gene.

> Explain, at the molecular level, why human genetic diseases often follow a simple Mendelian pattern of inheritance, whereas most normal traits, such as the shape of your nose or the size of your head, are governed by multiple gene interactions.

> Some people have a genetic predisposition for developing prion diseases. Examples are described in Table 25.6. In the case of Gerstmann-Straüssler-Scheinker disease, the age of onset is typically 30–50 years, and the dura

> What is a prion? Explain how a prion relies on normal cellular proteins to cause a disease such as mad cow disease.

> What is the purpose of the International HapMap Project? How will it help researchers who study disease-causing alleles?

> Describe the two assumptions that underlie the identification of disease-causing alleles via haplotypes.

> Sandhoff disease is due to a mutation in a gene that encodes a protein called hexosaminidase B. This disease has symptoms that are similar to those of Tay-Sachs disease. Weakness begins in the first 6 months of life. Individuals exhibit early blindness a

> Which data provide the strongest evidence that O1 is not the only operator site?

> Marfan syndrome is due to a mutation in a gene that encodes a protein called fibrillin-1. It is inherited as a dominant trait. The fibrillin-1 protein is the main constituent of extracellular microfibrils. These microfibrils can exist as individual fiber

> Lesch-Nyhan syndrome is due to a mutation in a gene that encodes a protein called hypoxanthine-guanine phosphoribosyltransferase (HPRT). HPRT is an enzyme that functions in purine metabolism. People afflicted with this syndrome have severe neurodegenerat

> Achondroplasia is a rare form of dwarfism caused by an autosomal dominant mutation that affects the gene that encodes a fibroblast growth factor receptor. Among 1,422,000 live births, the number of babies born with achondroplasia was 31. Among those 31 b

> Like Hurler syndrome, Fabry disease involves an abnormal accumulation of substances within lysosomes. However, the lysosomes of individuals with Fabry disease show an abnormal accumulation of lipids. The defective enzyme is α-galactosidase A, which is a

> Hurler syndrome is due to a mutation in a gene that encodes a protein called α-l-iduronidase. This protein functions within lysosomes as an enzyme that breaks down mucopolysaccharides (a type of polysaccharide that has many acidic groups at

> With regard to pedigree analysis, make a list of observations that distinguish recessive, dominant, and X-linked patterns of inheritance.

> What part of the A. tumefaciens DNA gets transferred to the genome of a plant cell during infection?

> What is a transgenic organism? Describe three examples.

> What is a mouse model for human disease?

> As shown in Table 22.2, several medical agents are now commercially produced by genetically engineered microorganisms. Discuss the advantages and disadvantages of making these agents this way. From Table 22.2: Examples of Medical Agents Produced by

> Why is it beneficial for the bacterium to regulate the lac operon with both a repressor protein and an activator protein?

> Which is more common anagenesis or cladogenesis?

> In a strain of mice, the average 6-week body weight is 25 g, and the narrow-sense heritability for this trait is 0.21. A. What would be the average weight of the offspring if parents with a mean weight of 27 g were chosen? B. What parental mean weight

> The average thorax length in a Drosophila population is 1.01 mm. You want to practice selective breeding to make larger Drosophila. To do so, you choose 10 parents (5 males and 5 females) of the following sizes: 0.97, 0.99, 1.05, 1.06, 1.03, 1.21, 1.22,

> In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2 g2. In another strain of highly inbred tomatoes raised under the same environmental conditions, the phenotypic variance is 2.2 g2. With regard to the wild strain, A. Est

> Outline the steps you would follow to determine the number of genes that influence the yield of rice. Describe the results you might get if rice yield is governed by variation in six different genes.

> Let’s suppose that two strains of pigs differ in 500 RFLPs. One strain is much larger than the other. The pigs are crossed to each other, and the members of the F1 generation are also crossed among themselves to produce an F2 generation. Three distinct R

> From an experimental viewpoint, what does it mean to say that an RFLP is associated with a trait? Let’s suppose that two strains of pea plants differ in two RFLPs that are linked to two genes governing pea size. RFLP-1 is found in 2000-bp and 2700-bp ban

> You conduct an RFLP analysis of head weight in one strain of cabbage; you determine that seven QTLs affect this trait. In another strain of cabbage, you find that only four QTLs affect this trait. Note that both strains of cabbage are from the same speci

> The abdomen length (in millimeters) was measured in 15 male Drosophila, and the following data were obtained: 1.9, 2.4, 2.1, 2.0, 2.2, 2.4, 1.7, 1.8, 2.0, 2.0, 2.3, 2.1, 1.6, 2.3, and 2.2. Calculate the mean, standard deviation, and variance for this pop

> The trait of blood pressure in humans has a frequency distribution that is similar to a normal distribution. The following graph shows the ranges of blood pressures for a selected population of people. The red line depicts the frequency distribution of t

> An animal breeder had a herd of sheep with a mean weight of 254 pounds at 3 years of age. He chose animals with a mean weight of 281 pounds as parents for the next generation. When these offspring reached 3 years of age, their mean weight was 269 pounds.

> Under what conditions is lac repressor bound to the lac operon?

> For each of the following relationships, correlation coefficients for height were determined for 15 pairs of individuals: Mother-daughter: 0.36 Mother-granddaughter: 0.17 Sister-sister: 0.39 Sister-sister (fraternal twins): 0.40 Sister-sister (identi

> A large, genetically heterogeneous group of tomato plants was used as the original breeding stock by two different breeders, named Mary and Hector. Each breeder was given 50 seeds and began an artificial selection strategy, much like the one described in

> A danger in computing heritability values from studies involving genetically related individuals is the possibility that these individuals share more similar environments than do unrelated individuals. In the experiment shown in Figure 28.8,

> A recessive lethal allele has achieved a frequency of 0.22 due to genetic drift in a very small population. Based on natural selection, how would you expect the allele frequencies to change in the next three generations? (Note: Your calculation can assum

> In the Grants’ study of the medium ground finch, do you think the pattern of natural selection was directional, stabilizing, disruptive, or balancing? Explain your answer. If the environment remained dry indefinitely (for many years), what do you think w

> Describe, in as much experimental detail as possible, how you would test the hypothesis that the distribution of shell color among land snails is due to predation.

> Resistance to the poison warfarin is a genetically determined trait in rats. Homozygotes carrying the resistance allele (WR WR ) have a lower fitness because they suffer from vitamin K deficiency, but heterozygotes (WR WS ) do not have this deficiency. H

> You will need to refer to question 2 in More Genetic TIPS before answering this question. In an island population, the following data were obtained for the numbers of people with each of the four blood types: Type O 721 Type A 932 Type B 235 Type AB 112

> The human MN blood group is determined by two codominant alleles, M and N. The following data were obtained from five human populations: A. Calculate the allele frequencies in these five populations. B. Which populations appear to be in Hardy-Weinberg

> Which genes are under the control of the lac promoter?

> In a large herd of 5468 sheep, 76 animals have yellow fat, and the rest of the members of the herd have white fat. Yellow fat is inherited as a recessive trait. This herd is assumed to be in Hardy-Weinberg equilibrium. A. What are the frequencies of the

> You will need to refer to question 2 in More Genetic TIPS to answer this question. The gene for coat color in rabbits can exist in four alleles termed C (full coat color), cch (chinchilla), c h (Himalayan), and c (albino). In a population of rabbits in H

> When analyzing the automated DNA fingerprints of a father and his biological daughter, a technician examined 50 peaks and found that 30 of them were a perfect match. In other words, 30 out of 50 peaks, or 60%, were a perfect match. Is this percentage too

> What is DNA fingerprinting? How can it be used in human identification?

> Look at question 5 in More Genetic TIPS before answering this question. Here are traditional DNA fingerprints of five people: a child, the mother, and three potential fathers: Which males can be ruled out as being the father? Explain your answer. If one

> In a donor population, the allele frequencies for the common (HbA ) and sickle cell (HbS ) alleles are 0.9 and 0.1, respectively. A group of 550 individuals from this population migrates to another population containing 10,000 individuals; in the recipie

> Among a large population of 2 million gray mosquitoes, one mosquito is heterozygous for a body color gene; this mosquito has one gray allele and one blue allele. There is no selective advantage or disadvantage between gray and blue body color. All of the

> You will need to be familiar with the techniques described in Chapter 21 to answer this question. Gene polymorphisms can be detected using a variety of cellular and molecular techniques. Which techniques would you use to detect gene polymorphisms at the

> You need to understand question 3 in More Genetic TIPS before answering this question. If the artificial gene containing the stripe 2 enhancer and the β-galactosidase gene were found within an embryo that also contained the following loss-of-function mut

> All of the homeotic genes in Drosophila have been cloned. As discussed in Chapter 21, cloned genes can be manipulated in vitro. They can be subjected to cutting and pasting, gene mutagenesis, etc. After Drosophila genes have been altered in vitro, they c

> Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?

> Take a look at question 2 in More Genetic TIPS before answering this question. Drosophila embryos carrying a ts mutation were exposed to the permissive (25°C) or nonpermissive (30°C) temperature at different stages of development. E

> Shown next are cell lineages determined from analyses of hypodermal cells in wild-type and mutant strains of C. elegans. Explain the nature of the mutations in the altered strains. Wild type Mutant 1 Mutant 2 V6 V6 V6 L1 10 L2- 20 11 L3 30 11 L4 40

> Explain the rationale behind the use of the “bag of worms” phenotype as a way to identify heterochronic mutations.

> Explain why a cell lineage diagram is necessary to determine if a mutation is heterochronic.

> What is meant by the term cell fate? What is a cell lineage diagram? Discuss the experimental advantage of having a cell lineage diagram. What is a cell lineage?

> Compare and contrast the experimental advantages of Drosophila and C. elegans in the study of developmental genetics.

> Below is a short nucleotide sequence from a gene. Use the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTC

> Why have geneticists used reverse genetics to study the genes involved in vertebrate development? Explain how this strategy differs from traditional genetic analyses like those done by Mendel.

> Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subs

> In the experiment of Figure 26.16, suggest reasons why the n536, n355, and n540 strains have an egg-laying defect From Figure 26.16: Answer: An egg-laying defect is somehow related to an abnormal anatomy. The n540 strain has fewer neurons compared to a

> Which RNA conformation favors transcription—the form with the antiterminator stem-loop or the form with the terminator stem-loop?

> Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.

> Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 21, Northern blotting is used to detect RNA that is transcribed from a particu

> Researchers have used the cloning methods described in Chapter 21 to clone the bicoid gene and express large amounts of the Bicoid protein. The Bicoid protein was then injected into the posterior end of a zygote immediately after fertilization. What phen

> In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a polypeptide and runs a program that is opposite to the program de

> Discuss why it is useful to search a database to identify sequences that are homologous to a newly determined sequence.

> What is a motif? Why is it useful for computer programs to identify functional motifs within amino acid sequences?

> Discuss the bioinformatics approaches that can be used to identify a protein-encoding gene.

> Describe the two general types of protein microarrays. What are their possible applications?

> How does population size affect genetic drift?

> What are two reasons why a selection limit is reached in which artificial selection no longer has an effect?

> Why is feedback inhibition an advantage to the bacterium?

> Discuss the types of traits that have been subjected to selective breeding in this example.

> What are the similarities and differences between natural selection and selective breeding?

> What are the two ways that strains A and B differ?

> Explain how gene number and environmental variation affect the overlaps between phenotypes and different genotypes.

> What does it mean to say that these alleles are additive?

> What percentage of individuals fall more than 2 SDs above the mean?

> How does inbreeding affect the likelihood that recessive traits will be expressed? Explain.

> What is happening at the bottleneck? Describe the effect of genetic drift during the bottleneck.

> Is height a discontinuous (discrete) trait, or does it follow a continuum?

> In general, why does stabilizing selection decrease genetic diversity?

> What is an advantage of gene regulation?