In general, why does stabilizing selection decrease genetic diversity?
> A recessive lethal allele has achieved a frequency of 0.22 due to genetic drift in a very small population. Based on natural selection, how would you expect the allele frequencies to change in the next three generations? (Note: Your calculation can assum
> In the Grants’ study of the medium ground finch, do you think the pattern of natural selection was directional, stabilizing, disruptive, or balancing? Explain your answer. If the environment remained dry indefinitely (for many years), what do you think w
> Describe, in as much experimental detail as possible, how you would test the hypothesis that the distribution of shell color among land snails is due to predation.
> Resistance to the poison warfarin is a genetically determined trait in rats. Homozygotes carrying the resistance allele (WR WR ) have a lower fitness because they suffer from vitamin K deficiency, but heterozygotes (WR WS ) do not have this deficiency. H
> You will need to refer to question 2 in More Genetic TIPS before answering this question. In an island population, the following data were obtained for the numbers of people with each of the four blood types: Type O 721 Type A 932 Type B 235 Type AB 112
> The human MN blood group is determined by two codominant alleles, M and N. The following data were obtained from five human populations: A. Calculate the allele frequencies in these five populations. B. Which populations appear to be in Hardy-Weinberg
> Which genes are under the control of the lac promoter?
> In a large herd of 5468 sheep, 76 animals have yellow fat, and the rest of the members of the herd have white fat. Yellow fat is inherited as a recessive trait. This herd is assumed to be in Hardy-Weinberg equilibrium. A. What are the frequencies of the
> You will need to refer to question 2 in More Genetic TIPS to answer this question. The gene for coat color in rabbits can exist in four alleles termed C (full coat color), cch (chinchilla), c h (Himalayan), and c (albino). In a population of rabbits in H
> When analyzing the automated DNA fingerprints of a father and his biological daughter, a technician examined 50 peaks and found that 30 of them were a perfect match. In other words, 30 out of 50 peaks, or 60%, were a perfect match. Is this percentage too
> What is DNA fingerprinting? How can it be used in human identification?
> Look at question 5 in More Genetic TIPS before answering this question. Here are traditional DNA fingerprints of five people: a child, the mother, and three potential fathers: Which males can be ruled out as being the father? Explain your answer. If one
> In a donor population, the allele frequencies for the common (HbA ) and sickle cell (HbS ) alleles are 0.9 and 0.1, respectively. A group of 550 individuals from this population migrates to another population containing 10,000 individuals; in the recipie
> Among a large population of 2 million gray mosquitoes, one mosquito is heterozygous for a body color gene; this mosquito has one gray allele and one blue allele. There is no selective advantage or disadvantage between gray and blue body color. All of the
> You will need to be familiar with the techniques described in Chapter 21 to answer this question. Gene polymorphisms can be detected using a variety of cellular and molecular techniques. Which techniques would you use to detect gene polymorphisms at the
> You need to understand question 3 in More Genetic TIPS before answering this question. If the artificial gene containing the stripe 2 enhancer and the β-galactosidase gene were found within an embryo that also contained the following loss-of-function mut
> All of the homeotic genes in Drosophila have been cloned. As discussed in Chapter 21, cloned genes can be manipulated in vitro. They can be subjected to cutting and pasting, gene mutagenesis, etc. After Drosophila genes have been altered in vitro, they c
> Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?
> Take a look at question 2 in More Genetic TIPS before answering this question. Drosophila embryos carrying a ts mutation were exposed to the permissive (25°C) or nonpermissive (30°C) temperature at different stages of development. E
> Shown next are cell lineages determined from analyses of hypodermal cells in wild-type and mutant strains of C. elegans. Explain the nature of the mutations in the altered strains. Wild type Mutant 1 Mutant 2 V6 V6 V6 L1 10 L2- 20 11 L3 30 11 L4 40
> Explain the rationale behind the use of the “bag of worms” phenotype as a way to identify heterochronic mutations.
> Explain why a cell lineage diagram is necessary to determine if a mutation is heterochronic.
> What is meant by the term cell fate? What is a cell lineage diagram? Discuss the experimental advantage of having a cell lineage diagram. What is a cell lineage?
> Compare and contrast the experimental advantages of Drosophila and C. elegans in the study of developmental genetics.
> Below is a short nucleotide sequence from a gene. Use the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTC
> Why have geneticists used reverse genetics to study the genes involved in vertebrate development? Explain how this strategy differs from traditional genetic analyses like those done by Mendel.
> Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subs
> In the experiment of Figure 26.16, suggest reasons why the n536, n355, and n540 strains have an egg-laying defect From Figure 26.16: Answer: An egg-laying defect is somehow related to an abnormal anatomy. The n540 strain has fewer neurons compared to a
> Which RNA conformation favors transcription—the form with the antiterminator stem-loop or the form with the terminator stem-loop?
> Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.
> Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 21, Northern blotting is used to detect RNA that is transcribed from a particu
> Researchers have used the cloning methods described in Chapter 21 to clone the bicoid gene and express large amounts of the Bicoid protein. The Bicoid protein was then injected into the posterior end of a zygote immediately after fertilization. What phen
> In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a polypeptide and runs a program that is opposite to the program de
> Discuss why it is useful to search a database to identify sequences that are homologous to a newly determined sequence.
> What is a motif? Why is it useful for computer programs to identify functional motifs within amino acid sequences?
> Discuss the bioinformatics approaches that can be used to identify a protein-encoding gene.
> Describe the two general types of protein microarrays. What are their possible applications?
> How does population size affect genetic drift?
> What are two reasons why a selection limit is reached in which artificial selection no longer has an effect?
> Why is feedback inhibition an advantage to the bacterium?
> Discuss the types of traits that have been subjected to selective breeding in this example.
> What are the similarities and differences between natural selection and selective breeding?
> What are the two ways that strains A and B differ?
> Explain how gene number and environmental variation affect the overlaps between phenotypes and different genotypes.
> What does it mean to say that these alleles are additive?
> What percentage of individuals fall more than 2 SDs above the mean?
> How does inbreeding affect the likelihood that recessive traits will be expressed? Explain.
> What is happening at the bottleneck? Describe the effect of genetic drift during the bottleneck.
> Is height a discontinuous (discrete) trait, or does it follow a continuum?
> What is an advantage of gene regulation?
> Does this form of natural selection favor polymorphism? Explain why or why not.
> Explain how negative frequency-dependent selection works.
> Explain why the HbS allele is prevalent in certain regions even though it is detrimental in the homozygous condition.
> In this example, is directional selection promoting genetic diversity? Explain.
> With respect to this form of natural selection, explain the meaning of the word directional.
> Are polymorphisms common or rare in natural populations?
> What does the term local population mean?
> What is an ortholog?
> What is a cell lineage?
> Explain how the physical arrangements of the homeotic genes correlate with their effects on phenotype.
> What would be the expected result if gene A was inactive?
> Describe the difference in the effects of a mutation in a gap gene versus one in a pair-rule gene.
> Where are maternal-effect gene products made first? Where do they go?
> What is the normal function of the Bicoid protein?
> Describe the orientations of the anteroposterior and dorsoventral axes.
> How does genetics play a role in development?
> Why is it important to maintain the correct number of stem cells in the growing tip?
> At which stage of development does the Id protein function? Why is its function important?
> Briefly describe how the HoxC-6 gene affects vertebrate development.
> Which of these mechanisms involve(s) diffusible morphogens?
> What are advantages and disadvantages of these two methods? From figure 22.15: Liposome -DNA canying the gene of interest Retrovirus- RNA genome contains gene of interest RNA genome Target cell Target cell DNA-liposome complex is taken into the targ
> What are two common applications of DNA fingerprinting?
> Which portion of a T-DNA vector is transferred to a plant?
> Is this a sequencing by synthesis method? Explain.
> Why is this technique used?
> Explain why the sequences of these two genes are similar to each other but not identical.
> What is the purpose of tandem mass spectrometry?
> Explain how these mechanisms affect protein diversity.
> Why is an antibody used in this experiment? From figure 24.2: wwww -Protein of interest The goal is to determine where in the genome this protein binds. Add formaldehyde to crosslink protein to DNA. Lyse the cells. Sonicate DNA into small pieces Ad
> What is an advantage and a disadvantage of this repair system?
> Which of the three Mut proteins is responsible for ensuring that the mismatched base in the newly made daughter strand is the one that is removed?
> Explain why cuts are made on both sides of the damaged region of the DNA.
> Describe two differences among these chromosomes.
> How does the binding of a protein to DNA influence the ability of DNase I to cleave the DNA?
> Explain how this experiment provides information regarding the expression of genes. From Figure 24.1: A mixture of 3 different types of MRNA A portion of a DNA microarray. Each spot contains single-stranded DNA from a specific gene. A Add reverae tr
> If a cell cannot make any Rb protein, how will this affect the function of E2F?
> Why does this translocation cause leukemia rather than cancer in a different tissue type, such as the lung?
> How would a mutation that prevents the Ras protein from hydrolyzing GTP affect the cell-signaling pathway in Figure 25.11? From Figure 25.11: EGF receptor EGF Ras GRB2 Ras Raf-1 GTP GDP GRB2 Raf-1 GDP MEK МЕК МАРК MAPKEB АРК Exposure to EGF Jun Fos
> Where does the prion protein come from?
> Explain the connection between the founder and the G8-C marker.
> What is a haplotype?
> What feature(s) of this pedigree indicate(s) X-linked recessive inheritance? Prince Albert Queen Victoria Victoria King Edward VII Leopold, Duke of Beatrice Albany Alice of Empress Frederick Hesse King Alfonso XII of Spain Frederick William King Geor
> What feature(s) of this pedigree indicate(s) dominant inheritance? I-1 I-I II-2 Il-3 II-4 I1-5 Il-6 Il-7 III-1 III-2 III-3 III-4
> With regard to phylogenetic trees, how is a molecular clock useful?
> Does this figure illustrate a strength or a drawback of using morphological traits to establish species? From Figure 29.1: (a) Frogs of the same species Ameri Eastern meadowlark (Stumella magna) Western meadowlark Western meadowlark (Sturnela neglec
> Christmas and Thanksgiving, two beloved traditional holidays, share many similarities concerning the gifts and memories they provide to thousands every year, and yet starkly contrast one another in their worldwide appreciation. Both holidays represent th
> The wildlife department has been feeding a special food to rainbow trout fingerlings in a pond. Based on a large number of observations, the distribution of trout weights is normally distributed with a mean of 402.7 grams and a standard deviation 8.8 gra
> Amid students in a certain Capstone group, 60% have taken Linear Algebra, 50% have taken Calculus 3, and 30% have taken both. What portion of the student? A. Did not take Calculus 3? B. Did not take either Linear Algebra or Calculus 3? C. Took Linear Alg
> Which of the following statements is always true? Select one: a. -1 ≤ P(Ei) ≤1 b. P(A) = 1 - P(Ac) c. P(A) + P(B) = 1 d. åP ≤ 1
> Draw the product of the allowing reaction between a ketone and an alcohol. Include hydrogen atoms in your structural formula. + 1 mole equiv. но-снз-сн H* H3C Tools
