Question: Two techniques commonly used to study the
Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 21, Northern blotting is used to detect RNA that is transcribed from a particular gene. In this method, a specific RNA is detected by using a short segment of cloned DNA as a probe. The DNA probe, which is labeled, is complementary to the RNA that the researcher wishes to detect. After the DNA probe binds to the RNA within a blot of a gel, the RNA is visualized as a labeled band on a nylon membrane. For example, a DNA probe that is complementary to the bicoid mRNA could be used to specifically detect the amount of that mRNA in a blot.
A second technique, termed fluorescence in situ hybridization (FISH), is used to identify the locations of genes on chromosomes. This technique is also used to locate gene products within oocytes, embryos, and larvae. Thus, it has been commonly used by developmental geneticists to understand the expression patterns of genes during development. The micrograph in Figure 26.8b is derived from the application of the FISH technique. In this case, the probe was complementary to bicoid mRNA.
Now here is the question. Suppose a researcher has three different Drosophila strains that have loss-of-function mutations in the bicoid gene. We will call them bicoid-A, bicoid-B, and bicoid-C; the wild type is designated bicoid+. To study these mutations, phenotypically normal female flies that are homozygous for each bicoid mutation were obtained, and their oocytes were analyzed using these two techniques. A wild-type strain was also analyzed as a control. In other words, RNA was isolated from some oocytes and analyzed by Northern blotting, and some oocytes were subjected to in situ hybridization. In both cases, the probe was complementary to the bicoid mRNA. The results are shown next.
A. How can phenotypically normal female flies be homozygous for a loss-of-function allele in the bicoid gene?
B. Explain the type of mutation (e.g., deletion, point mutation, etc.) in each of the three strains. Explain how the mutation may cause a loss of normal function for the bicoid gene product.
C. Discuss how the use of both techniques provides more definitive information than the application of just one of the techniques.
Transcribed Image Text:
Northern blot 1 2 3 Lane 1. Wild type (bicoid") Lane 2. bicoid-A Lane 3. bicoid-B Lane 4. bicoid-C In situ hybridization Wild type bicold-A bicoid-B bicoid-C
> What is a mouse model for human disease?
> As shown in Table 22.2, several medical agents are now commercially produced by genetically engineered microorganisms. Discuss the advantages and disadvantages of making these agents this way. From Table 22.2: Examples of Medical Agents Produced by
> Why is it beneficial for the bacterium to regulate the lac operon with both a repressor protein and an activator protein?
> Which is more common anagenesis or cladogenesis?
> In a strain of mice, the average 6-week body weight is 25 g, and the narrow-sense heritability for this trait is 0.21. A. What would be the average weight of the offspring if parents with a mean weight of 27 g were chosen? B. What parental mean weight
> The average thorax length in a Drosophila population is 1.01 mm. You want to practice selective breeding to make larger Drosophila. To do so, you choose 10 parents (5 males and 5 females) of the following sizes: 0.97, 0.99, 1.05, 1.06, 1.03, 1.21, 1.22,
> In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2 g2. In another strain of highly inbred tomatoes raised under the same environmental conditions, the phenotypic variance is 2.2 g2. With regard to the wild strain, A. Est
> Outline the steps you would follow to determine the number of genes that influence the yield of rice. Describe the results you might get if rice yield is governed by variation in six different genes.
> Let’s suppose that two strains of pigs differ in 500 RFLPs. One strain is much larger than the other. The pigs are crossed to each other, and the members of the F1 generation are also crossed among themselves to produce an F2 generation. Three distinct R
> From an experimental viewpoint, what does it mean to say that an RFLP is associated with a trait? Let’s suppose that two strains of pea plants differ in two RFLPs that are linked to two genes governing pea size. RFLP-1 is found in 2000-bp and 2700-bp ban
> You conduct an RFLP analysis of head weight in one strain of cabbage; you determine that seven QTLs affect this trait. In another strain of cabbage, you find that only four QTLs affect this trait. Note that both strains of cabbage are from the same speci
> The abdomen length (in millimeters) was measured in 15 male Drosophila, and the following data were obtained: 1.9, 2.4, 2.1, 2.0, 2.2, 2.4, 1.7, 1.8, 2.0, 2.0, 2.3, 2.1, 1.6, 2.3, and 2.2. Calculate the mean, standard deviation, and variance for this pop
> The trait of blood pressure in humans has a frequency distribution that is similar to a normal distribution. The following graph shows the ranges of blood pressures for a selected population of people. The red line depicts the frequency distribution of t
> An animal breeder had a herd of sheep with a mean weight of 254 pounds at 3 years of age. He chose animals with a mean weight of 281 pounds as parents for the next generation. When these offspring reached 3 years of age, their mean weight was 269 pounds.
> Under what conditions is lac repressor bound to the lac operon?
> For each of the following relationships, correlation coefficients for height were determined for 15 pairs of individuals: Mother-daughter: 0.36 Mother-granddaughter: 0.17 Sister-sister: 0.39 Sister-sister (fraternal twins): 0.40 Sister-sister (identi
> A large, genetically heterogeneous group of tomato plants was used as the original breeding stock by two different breeders, named Mary and Hector. Each breeder was given 50 seeds and began an artificial selection strategy, much like the one described in
> A danger in computing heritability values from studies involving genetically related individuals is the possibility that these individuals share more similar environments than do unrelated individuals. In the experiment shown in Figure 28.8,
> Here are data for height and weight among 10 male college students. A. Calculate the correlation coefficient for height and weight for this group. B. Is the correlation coefficient statistically significant? Explain. Height (cm) Weight (kg) 159 48
> A recessive lethal allele has achieved a frequency of 0.22 due to genetic drift in a very small population. Based on natural selection, how would you expect the allele frequencies to change in the next three generations? (Note: Your calculation can assum
> In the Grants’ study of the medium ground finch, do you think the pattern of natural selection was directional, stabilizing, disruptive, or balancing? Explain your answer. If the environment remained dry indefinitely (for many years), what do you think w
> Describe, in as much experimental detail as possible, how you would test the hypothesis that the distribution of shell color among land snails is due to predation.
> Resistance to the poison warfarin is a genetically determined trait in rats. Homozygotes carrying the resistance allele (WR WR ) have a lower fitness because they suffer from vitamin K deficiency, but heterozygotes (WR WS ) do not have this deficiency. H
> You will need to refer to question 2 in More Genetic TIPS before answering this question. In an island population, the following data were obtained for the numbers of people with each of the four blood types: Type O 721 Type A 932 Type B 235 Type AB 112
> The human MN blood group is determined by two codominant alleles, M and N. The following data were obtained from five human populations: A. Calculate the allele frequencies in these five populations. B. Which populations appear to be in Hardy-Weinberg
> Which genes are under the control of the lac promoter?
> In a large herd of 5468 sheep, 76 animals have yellow fat, and the rest of the members of the herd have white fat. Yellow fat is inherited as a recessive trait. This herd is assumed to be in Hardy-Weinberg equilibrium. A. What are the frequencies of the
> You will need to refer to question 2 in More Genetic TIPS to answer this question. The gene for coat color in rabbits can exist in four alleles termed C (full coat color), cch (chinchilla), c h (Himalayan), and c (albino). In a population of rabbits in H
> When analyzing the automated DNA fingerprints of a father and his biological daughter, a technician examined 50 peaks and found that 30 of them were a perfect match. In other words, 30 out of 50 peaks, or 60%, were a perfect match. Is this percentage too
> What is DNA fingerprinting? How can it be used in human identification?
> Look at question 5 in More Genetic TIPS before answering this question. Here are traditional DNA fingerprints of five people: a child, the mother, and three potential fathers: Which males can be ruled out as being the father? Explain your answer. If one
> In a donor population, the allele frequencies for the common (HbA ) and sickle cell (HbS ) alleles are 0.9 and 0.1, respectively. A group of 550 individuals from this population migrates to another population containing 10,000 individuals; in the recipie
> Among a large population of 2 million gray mosquitoes, one mosquito is heterozygous for a body color gene; this mosquito has one gray allele and one blue allele. There is no selective advantage or disadvantage between gray and blue body color. All of the
> You will need to be familiar with the techniques described in Chapter 21 to answer this question. Gene polymorphisms can be detected using a variety of cellular and molecular techniques. Which techniques would you use to detect gene polymorphisms at the
> You need to understand question 3 in More Genetic TIPS before answering this question. If the artificial gene containing the stripe 2 enhancer and the β-galactosidase gene were found within an embryo that also contained the following loss-of-function mut
> All of the homeotic genes in Drosophila have been cloned. As discussed in Chapter 21, cloned genes can be manipulated in vitro. They can be subjected to cutting and pasting, gene mutagenesis, etc. After Drosophila genes have been altered in vitro, they c
> Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?
> Take a look at question 2 in More Genetic TIPS before answering this question. Drosophila embryos carrying a ts mutation were exposed to the permissive (25°C) or nonpermissive (30°C) temperature at different stages of development. E
> Shown next are cell lineages determined from analyses of hypodermal cells in wild-type and mutant strains of C. elegans. Explain the nature of the mutations in the altered strains. Wild type Mutant 1 Mutant 2 V6 V6 V6 L1 10 L2- 20 11 L3 30 11 L4 40
> Explain the rationale behind the use of the “bag of worms” phenotype as a way to identify heterochronic mutations.
> Explain why a cell lineage diagram is necessary to determine if a mutation is heterochronic.
> What is meant by the term cell fate? What is a cell lineage diagram? Discuss the experimental advantage of having a cell lineage diagram. What is a cell lineage?
> Compare and contrast the experimental advantages of Drosophila and C. elegans in the study of developmental genetics.
> Below is a short nucleotide sequence from a gene. Use the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTC
> Why have geneticists used reverse genetics to study the genes involved in vertebrate development? Explain how this strategy differs from traditional genetic analyses like those done by Mendel.
> Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte or embryo, and then determine how this affects the subs
> In the experiment of Figure 26.16, suggest reasons why the n536, n355, and n540 strains have an egg-laying defect From Figure 26.16: Answer: An egg-laying defect is somehow related to an abnormal anatomy. The n540 strain has fewer neurons compared to a
> Which RNA conformation favors transcription—the form with the antiterminator stem-loop or the form with the terminator stem-loop?
> Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.
> Researchers have used the cloning methods described in Chapter 21 to clone the bicoid gene and express large amounts of the Bicoid protein. The Bicoid protein was then injected into the posterior end of a zygote immediately after fertilization. What phen
> In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a polypeptide and runs a program that is opposite to the program de
> Discuss why it is useful to search a database to identify sequences that are homologous to a newly determined sequence.
> What is a motif? Why is it useful for computer programs to identify functional motifs within amino acid sequences?
> Discuss the bioinformatics approaches that can be used to identify a protein-encoding gene.
> Describe the two general types of protein microarrays. What are their possible applications?
> How does population size affect genetic drift?
> What are two reasons why a selection limit is reached in which artificial selection no longer has an effect?
> Why is feedback inhibition an advantage to the bacterium?
> Discuss the types of traits that have been subjected to selective breeding in this example.
> What are the similarities and differences between natural selection and selective breeding?
> What are the two ways that strains A and B differ?
> Explain how gene number and environmental variation affect the overlaps between phenotypes and different genotypes.
> What does it mean to say that these alleles are additive?
> What percentage of individuals fall more than 2 SDs above the mean?
> How does inbreeding affect the likelihood that recessive traits will be expressed? Explain.
> What is happening at the bottleneck? Describe the effect of genetic drift during the bottleneck.
> Is height a discontinuous (discrete) trait, or does it follow a continuum?
> In general, why does stabilizing selection decrease genetic diversity?
> What is an advantage of gene regulation?
> Does this form of natural selection favor polymorphism? Explain why or why not.
> Explain how negative frequency-dependent selection works.
> Explain why the HbS allele is prevalent in certain regions even though it is detrimental in the homozygous condition.
> In this example, is directional selection promoting genetic diversity? Explain.
> With respect to this form of natural selection, explain the meaning of the word directional.
> Are polymorphisms common or rare in natural populations?
> What does the term local population mean?
> What is an ortholog?
> What is a cell lineage?
> Explain how the physical arrangements of the homeotic genes correlate with their effects on phenotype.
> What would be the expected result if gene A was inactive?
> Describe the difference in the effects of a mutation in a gap gene versus one in a pair-rule gene.
> Where are maternal-effect gene products made first? Where do they go?
> What is the normal function of the Bicoid protein?
> Describe the orientations of the anteroposterior and dorsoventral axes.
> How does genetics play a role in development?
> Why is it important to maintain the correct number of stem cells in the growing tip?
> At which stage of development does the Id protein function? Why is its function important?
> Briefly describe how the HoxC-6 gene affects vertebrate development.
> Which of these mechanisms involve(s) diffusible morphogens?
> What are advantages and disadvantages of these two methods? From figure 22.15: Liposome -DNA canying the gene of interest Retrovirus- RNA genome contains gene of interest RNA genome Target cell Target cell DNA-liposome complex is taken into the targ
> What are two common applications of DNA fingerprinting?
> Which portion of a T-DNA vector is transferred to a plant?
> Is this a sequencing by synthesis method? Explain.
> Why is this technique used?
> Explain why the sequences of these two genes are similar to each other but not identical.
> What is the purpose of tandem mass spectrometry?
> Explain how these mechanisms affect protein diversity.
> Why is an antibody used in this experiment? From figure 24.2: wwww -Protein of interest The goal is to determine where in the genome this protein binds. Add formaldehyde to crosslink protein to DNA. Lyse the cells. Sonicate DNA into small pieces Ad
> What is an advantage and a disadvantage of this repair system?
> Which of the three Mut proteins is responsible for ensuring that the mismatched base in the newly made daughter strand is the one that is removed?
