Question: Plant seeds contain storage proteins that are

> What are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.

> What is meant by the term transcription factor modulation? List three general ways this can occur.

> Discuss the structure and function of regulatory elements. Where are they located relative to the core promoter?

> Briefly describe three ways that ATP-dependent chromatin-remodeling complexes may change chromatin structure.

> The gene that encodes the enzyme called tyrosine hydroxylase is known to be activated by the CREB protein. Tyrosine hydroxylase is expressed in nerve cells and is involved in the synthesis of catecholamine, a neurotransmitter. The exposure of cells to ad

> The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a f

> An enhancer, located upstream from a gene, has the following sequence: 5′–GTAG–3′ 3′–CATC–5′ This enhancer is orientation-independent. Which of the following sequences also works as an enhancer? A. 5′–CTAC–3′ 3′–GATG–5′ B. 5′–GATG–3′ 3′–CTAC–5′ C.

> Transcription factors such as the glucocorticoid receptor and the CREB protein form homodimers and activate transcription. Other transcription factors form heterodimers. For example, a transcription factor known as myogenic bHLH forms a heterodimer with

> Explain why RISC binds to a specific mRNA. What type of bonding occurs?

> The glucocorticoid receptor and the CREB protein are two examples of transcriptional activators. These proteins bind to response elements and activate transcription. (Note: The answers to this question are not directly described in this chapter. You have

> A particular drug inhibits the protein kinase that is responsible for phosphorylating the CREB protein. How would this drug affect the following events? A. The ability of the CREB protein to bind to CREs B. The ability of extracellular hormones to enha

> Explain how phosphorylation affects the function of the CREB protein.

> Discuss the common points of control in eukaryotic gene regulation.

> If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of the repressor protein, how would the expression of the lac operon be affected?

> In the lac operon, how would gene expression be affected if each one of the following segments was missing? A. lac operon promoter B. Operator site C. lacA gene

> What is enzyme adaptation? From a genetic point of view, how does it occur?

> Some mutations have a cis-effect, whereas others have a transeffect. Explain the molecular differences between cis- and transmutations. Which type of mutation (cis or trans) can be complemented in a merozygote experiment?

> An operon is repressible—a small effector molecule turns off its transcription. Which combination(s) of small effector molecule and regulatory protein could be involved in this process? A. An inducer plus a repressor B. A corepressor plus a repressor

> Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a small effector molecule that binds to the regulatory protein. Do each of the following terms apply to a regulatory protein, a segment of DNA, or a small e

> What types of molecules can bind to a non-coding RNA?

> If a gene is repressible and under positive control, what kind of effector molecule and regulatory protein are involved in its regulation? Explain how the binding of the effector molecule affects the regulatory protein.

> Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these three mechanisms will be most effective in each of the

> How are the actions of lac repressor and trp repressor similar and how are they different with regard to their binding to operator sites, their effects on transcription, and the influences of small effector molecules?

> Using three examples, describe how allosteric sites are important in the function of genetic regulatory proteins.

> A species of bacteria can synthesize the amino acid histidine, so they do not require histidine in their growth medium. A key enzyme, which we will call histidine synthetase, is necessary for histidine biosynthesis. When these bacteria are given histidin

> In E. coli, a methyltransferase enzyme encoded by the dam gene recognizes the sequence 5′–GATC–3′ and attaches a methyl group to the nitrogen at position 6 of adenine. E. coli strains that have the dam gene deleted are known to have a higher spontaneous

> Discuss the similarities and differences between nucleotide excision repair and the mismatch repair system.

> Three common ways to repair changes in DNA structure are nucleotide excision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the following types of DNA changes? A. A change in the struct

> What is the underlying genetic defect that causes xeroderma pigmentosum? How can the symptoms of this disease be explained by the genetic defect?

> When DNA N-glycosylase recognizes a thymine dimer, it detects only the thymine located on the 5′ side of the dimer as being abnormal. Make a drawing and explain the steps whereby a thymine dimer is repaired by the consecutive actions of DNA N-glycosylase

> Are queen and worker bees genetically different from each other?

> With regard to the repair of double-strand breaks, what are the advantages and disadvantages of homologous recombination repair versus nonhomologous end joining?

> What are the two main mechanisms by which cells repair doublestrand breaks? Briefly describe each one.

> During mismatch repair, why is it necessary to distinguish between the template strand and the newly made daughter strand? How is this accomplished?

> How would nucleotide excision repair be affected if one of the following proteins was missing? Describe the condition of the DNA if the repair was attempted in the absence of the protein. A. UvrA B. UvrC C. UvrD D. DNA polymerase

> Explain how alternative splicing affects sex determination in Drosophila.

> Predict the phenotypic consequences of each of the following mutations: A. apetala1 defective B. pistillata defective C. apetala1 and pistillata defective

> Let’s suppose the mutation rate for converting a B allele into a b allele is 10–4. The current allele frequencies are B = 0.6 and b = 0.4. How long will it take for the allele frequencies to equal each other, assuming that no genetic drift takes place?

> Antibiotics are commonly used to combat bacterial and fungal infections. During the past several decades, however, antibioticresistant strains of microorganisms have become alarmingly prevalent. This has undermined the effectiveness of antibiotics in tre

> A family pedigree is shown here. A. What is the inbreeding coefficient for individual IV-2? Who is/ are her parents’ common ancestor(s)? B. Based on the data shown in this pedigree, is individual III-4 inbred? 1-1 I-2 Il-1 Il-2 II

> A family pedigree is shown here. A. What is the inbreeding coefficient for individual IV-3? B. Based on the data shown in this pedigree, is individual IV-4 inbred? 1-2 1-3 II-1 II-2 II-3 Il-4 Il-5 Il-6 III-1 III-2 III-3 III-4 III-5 III-6 III-7 III-

> In the F1 offspring, what happened to the B-I allele that was inherited from the parent at the top right?

> Using the pedigree shown here, answer the following questions for individual VI-1. A. Is this individual inbred? B. If so, who is/are her parents’ common ancestor(s)? C. Calculate the inbreeding coefficient for VI-1. D. Are the pare

> With regard to heterosis, is each of the following statements consistent with the dominance hypothesis, the overdominance hypothesis, or both? A. Strains that have been highly inbred have become monomorphic for one or more recessive alleles that are som

> If you were comparing the karyotypes of species that are closely related evolutionarily, what types of similarities and differences would you expect to find?

> As discussed in Chapter 27, genetic variation is prevalent in natural populations. This variation is revealed in the DNA sequencing of genes. Based on the neutral theory of evolution, discuss the relative importance of natural selection against detriment

> For each of the following examples, discuss whether the observed result is due to neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of homologous genes, differences in the coding sequence a

> Compare and contrast the neutral theory of evolution and the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution.

> Take a look at the α-globin and β-globin amino acid sequences in Figure 29.11. Which sequences are more similar, the α globin in humans and the α globin in horses, or the α globin in hum

> When comparing the coding regions of a protein-encoding gene among closely related species, certain regions are commonly found to have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions. Explain why different regions

> Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

> Describe how the compaction of nucleosomes into a knot-like structure could silence gene expression.

> Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

> What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

> The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line the

> Discuss the major differences among allopatric, parapatric, and sympatric speciation.

> Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

> Alloploids are produced by crosses involving two different species. Explain why alloploids may be reproductively isolated from the two original species from which they were derived. Explain why alloploids are usually sterile, whereas allotetraploids (con

> Explain the type of speciation (allopatric, parapatric, or sympatric) most likely to occur under each of the following conditions: A. A pregnant female rat is transported by an ocean liner to a new continent. B. A meadow containing several species of gr

> Describe three or more genetic mechanisms that may lead to the rapid evolution of a new species. Which of these genetic mechanisms are influenced by natural selection, and which are not?

> Distinguish between anagenesis and cladogenesis. Which mechanism of speciation is more prevalent? Why?

> Would each of the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism? A. Horses and donkeys can interbreed to produce mules, but the mules are infertile. B. Three species of the orchid genus Dendrobium prod

> In X-chromosome inactivation, when is the choice made as to which X chromosome is inactivated? Does this choice occur in embryonic cells, in adult somatic cells, or both?

> What is meant by the term reproductive isolation? Give several examples.

> What is a species? What types of observations do researchers analyze when trying to identify species?

> Evolution, which involves genetic changes in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular levels.

> Discuss the two principles on which evolution is based.

> What does it mean when a correlation coefficient is negative? Can you think of examples?

> If r = 0.5 and N = 4, would you conclude that a positive correlation exists between the two variables? Explain your answer. What if N = 500?

> Two different varieties of potato plants produce potatoes with the same mean weight of 1.5 pounds. One variety has a very low variance for potato weight, and the other has a much higher variance. A. Discuss the possible reasons for the differences in va

> The variance for weight in a particular herd of cattle is 484 pounds2 . The mean weight is 562 pounds. How heavy would an animal have to be if it was in the top 2.5% of the herd? The bottom 0.13%?

> What is a frequency distribution? Explain how such a graph is made for a quantitative trait that is continuous.

> Explain the difference between a continuous trait and a discontinuous trait. Give two examples of each. Are quantitative traits likely to be continuous or discontinuous? Explain why.

> Which of these patterns applies to the imprinting of the Igf2 gene, described in Chapter 5? From figure 16.3: Gene B expressed Gene B not expressed Gene Bexpressed Gene B not expressed Transcription factor Off Gene B Gene B O Gene B Gene B Cell fusi

> What is a normal distribution? Discuss this curve with regard to quantitative traits within a population. What is the relationship between the standard deviation and the normal distribution?

> Discuss whether a natural population of wolves or a domesticated population of German shepherds is more likely to have a higher heritability for the trait of size.

> When artificial selection is practiced over many generations, it is common for the trait to reach a plateau in which further selection has little effect on the outcome of the trait. This phenomenon is illustrated in Figure 28.11. Explain why it occurs.

> In a fairly large population of people living in a commune in the southern United States, everyone cares about good nutrition. All of the members of this population eat very nutritious foods, and their diets are very similar. How do you think the heights

> At the molecular level, explain why quantitative traits often exhibit a continuum of phenotypes within a population. How does the environment help produce this continuum?

> The heritability for egg weight in a group of chickens on a farm in Maine is 0.95. Are the following statements regarding this heritability true or false? If a statement is false, explain why. A. The environment in Maine has very little effect on the ou

> What is the difference between broad-sense heritability and narrow-sense heritability? Why is narrow-sense heritability such a useful concept in the field of agricultural genetics?

> In your own words, explain the meaning of the term heritability. Why is a heritability value valid only for a particular population of individuals raised in a particular environment?

> Many beautiful varieties of roses have been produced, particularly in the last few decades. These newer varieties often have very striking and showy flowers, making them desirable as horticultural specimens. However, breeders and novices alike have notic

> From an agricultural point of view, discuss the advantages and disadvantages of selective breeding. It is common for plant breeders to take two different, highly inbred strains, which are the product of many generations of selective breeding, and cross t

> Explain how DNA methylation could be transmitted by a cis-epigenetic mechanism.

> The broad-sense heritability for a trait equals 1.0. In your own words, explain what this value means. Would you conclude that the environment is unimportant in the outcome of this trait? Explain your answer.

> Let’s suppose that weight in a species of mammal is polygenic, and each gene exists as a heavy and light allele. If the allele frequencies in the population are equal for both types of alleles (i.e., 50% heavy alleles and 50% light alleles), what percent

> What is a quantitative trait locus (QTL)? Does a QTL contain one gene or multiple genes? What technique is commonly used to identify QTLs?

> What is polygenic inheritance? Discuss the issues that make polygenic inheritance difficult to study.

> When a correlation coefficient is statistically significant, what do you conclude about the two variables? What do the results mean with regard to cause and effect?

> Give several examples of quantitative traits. How are these quantitative traits described within groups of individuals?

> The ability to roll your tongue is inherited as a recessive trait. The frequency of the rolling allele is approximately 0.6, and that of the dominant (nonrolling) allele is 0.4. What is the frequency of individuals who can roll their tongues?

> In a population, the frequencies of two alleles are B = 0.67 and b = 0.33. The genotype frequencies are BB = 0.50, Bb = 0.37, and bb = 0.13. Do these numbers suggest inbreeding? Explain why or why not.

> For a gene existing in two alleles, what are the allele frequencies when the heterozygote frequency is at its maximum value, assuming Hardy-Weinberg equilibrium? What if there are three alleles?

> Cystic fibrosis (CF) is a recessive autosomal disorder. In certain populations of Northern European descent, the number of people born with this disorder is about 1 in 2500. Assuming HardyWeinberg equilibrium for this trait: A. What are the frequencies

> How might nucleosome eviction affect transcription?

> The term polymorphism can refer to both genes and traits. Explain what is meant by a polymorphic gene and a polymorphic trait. If a gene is polymorphic, does the trait that the gene affects also have to be polymorphic? Explain why or why not.

> Identify each of the following as an example of allele, genotype, and/or phenotype frequency: A. Approximately 1 in 2500 people of Northern European descent is born with cystic fibrosis. B. The percentage of carriers of the sickle cell allele in West A

> What is genetic polymorphism? What is the source of genetic variation?

> Does inbreeding affect allele frequencies? Why or why not? How does it affect genotype frequencies? With regard to rare recessive diseases, what are the consequences of inbreeding in human populations?