Question: Identify each of the following as an

> Plant seeds contain storage proteins that are encoded by the plant’s genes. When a seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polypeptides are broken), which releases amino acids for th

> When comparing the coding regions of a protein-encoding gene among closely related species, certain regions are commonly found to have evolved more rapidly (i.e., have tolerated more changes in sequence) than other regions. Explain why different regions

> Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

> Describe how the compaction of nucleosomes into a knot-like structure could silence gene expression.

> Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

> What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

> The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line the

> Discuss the major differences among allopatric, parapatric, and sympatric speciation.

> Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

> Alloploids are produced by crosses involving two different species. Explain why alloploids may be reproductively isolated from the two original species from which they were derived. Explain why alloploids are usually sterile, whereas allotetraploids (con

> Explain the type of speciation (allopatric, parapatric, or sympatric) most likely to occur under each of the following conditions: A. A pregnant female rat is transported by an ocean liner to a new continent. B. A meadow containing several species of gr

> Describe three or more genetic mechanisms that may lead to the rapid evolution of a new species. Which of these genetic mechanisms are influenced by natural selection, and which are not?

> Distinguish between anagenesis and cladogenesis. Which mechanism of speciation is more prevalent? Why?

> Would each of the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism? A. Horses and donkeys can interbreed to produce mules, but the mules are infertile. B. Three species of the orchid genus Dendrobium prod

> In X-chromosome inactivation, when is the choice made as to which X chromosome is inactivated? Does this choice occur in embryonic cells, in adult somatic cells, or both?

> What is meant by the term reproductive isolation? Give several examples.

> What is a species? What types of observations do researchers analyze when trying to identify species?

> Evolution, which involves genetic changes in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular levels.

> Discuss the two principles on which evolution is based.

> What does it mean when a correlation coefficient is negative? Can you think of examples?

> If r = 0.5 and N = 4, would you conclude that a positive correlation exists between the two variables? Explain your answer. What if N = 500?

> Two different varieties of potato plants produce potatoes with the same mean weight of 1.5 pounds. One variety has a very low variance for potato weight, and the other has a much higher variance. A. Discuss the possible reasons for the differences in va

> The variance for weight in a particular herd of cattle is 484 pounds2 . The mean weight is 562 pounds. How heavy would an animal have to be if it was in the top 2.5% of the herd? The bottom 0.13%?

> What is a frequency distribution? Explain how such a graph is made for a quantitative trait that is continuous.

> Explain the difference between a continuous trait and a discontinuous trait. Give two examples of each. Are quantitative traits likely to be continuous or discontinuous? Explain why.

> Which of these patterns applies to the imprinting of the Igf2 gene, described in Chapter 5? From figure 16.3: Gene B expressed Gene B not expressed Gene Bexpressed Gene B not expressed Transcription factor Off Gene B Gene B O Gene B Gene B Cell fusi

> What is a normal distribution? Discuss this curve with regard to quantitative traits within a population. What is the relationship between the standard deviation and the normal distribution?

> Discuss whether a natural population of wolves or a domesticated population of German shepherds is more likely to have a higher heritability for the trait of size.

> When artificial selection is practiced over many generations, it is common for the trait to reach a plateau in which further selection has little effect on the outcome of the trait. This phenomenon is illustrated in Figure 28.11. Explain why it occurs.

> In a fairly large population of people living in a commune in the southern United States, everyone cares about good nutrition. All of the members of this population eat very nutritious foods, and their diets are very similar. How do you think the heights

> At the molecular level, explain why quantitative traits often exhibit a continuum of phenotypes within a population. How does the environment help produce this continuum?

> The heritability for egg weight in a group of chickens on a farm in Maine is 0.95. Are the following statements regarding this heritability true or false? If a statement is false, explain why. A. The environment in Maine has very little effect on the ou

> What is the difference between broad-sense heritability and narrow-sense heritability? Why is narrow-sense heritability such a useful concept in the field of agricultural genetics?

> In your own words, explain the meaning of the term heritability. Why is a heritability value valid only for a particular population of individuals raised in a particular environment?

> Many beautiful varieties of roses have been produced, particularly in the last few decades. These newer varieties often have very striking and showy flowers, making them desirable as horticultural specimens. However, breeders and novices alike have notic

> From an agricultural point of view, discuss the advantages and disadvantages of selective breeding. It is common for plant breeders to take two different, highly inbred strains, which are the product of many generations of selective breeding, and cross t

> Explain how DNA methylation could be transmitted by a cis-epigenetic mechanism.

> The broad-sense heritability for a trait equals 1.0. In your own words, explain what this value means. Would you conclude that the environment is unimportant in the outcome of this trait? Explain your answer.

> Let’s suppose that weight in a species of mammal is polygenic, and each gene exists as a heavy and light allele. If the allele frequencies in the population are equal for both types of alleles (i.e., 50% heavy alleles and 50% light alleles), what percent

> What is a quantitative trait locus (QTL)? Does a QTL contain one gene or multiple genes? What technique is commonly used to identify QTLs?

> What is polygenic inheritance? Discuss the issues that make polygenic inheritance difficult to study.

> When a correlation coefficient is statistically significant, what do you conclude about the two variables? What do the results mean with regard to cause and effect?

> Give several examples of quantitative traits. How are these quantitative traits described within groups of individuals?

> The ability to roll your tongue is inherited as a recessive trait. The frequency of the rolling allele is approximately 0.6, and that of the dominant (nonrolling) allele is 0.4. What is the frequency of individuals who can roll their tongues?

> In a population, the frequencies of two alleles are B = 0.67 and b = 0.33. The genotype frequencies are BB = 0.50, Bb = 0.37, and bb = 0.13. Do these numbers suggest inbreeding? Explain why or why not.

> For a gene existing in two alleles, what are the allele frequencies when the heterozygote frequency is at its maximum value, assuming Hardy-Weinberg equilibrium? What if there are three alleles?

> Cystic fibrosis (CF) is a recessive autosomal disorder. In certain populations of Northern European descent, the number of people born with this disorder is about 1 in 2500. Assuming HardyWeinberg equilibrium for this trait: A. What are the frequencies

> How might nucleosome eviction affect transcription?

> The term polymorphism can refer to both genes and traits. Explain what is meant by a polymorphic gene and a polymorphic trait. If a gene is polymorphic, does the trait that the gene affects also have to be polymorphic? Explain why or why not.

> What is genetic polymorphism? What is the source of genetic variation?

> Does inbreeding affect allele frequencies? Why or why not? How does it affect genotype frequencies? With regard to rare recessive diseases, what are the consequences of inbreeding in human populations?

> Two populations of antelope are separated by a mountain range. The antelope are known to occasionally migrate from one population to the other. Migration can occur in either direction. Explain how migration affects the following phenomena: A. Genetic di

> When two populations frequently intermix due to migration, what are the long-term consequences with regard to allele frequencies and genetic variation?

> With regard to genetic drift, are the following statements true or false? If a statement is false, explain why. A. Over the long run, genetic drift leads to allele fixation or loss. B. When a new mutation occurs within a population, genetic drift is mo

> In genetics, what does the term population mean? Pick any species you like and describe how its population might change over the course of many generations.

> Describe what happens to allele frequencies as a result of the bottleneck effect. Discuss the relevance of this effect with regard to species that are approaching extinction.

> A group of four birds flies to a new location and initiates a new colony. Three of the birds are homozygous AA, and one bird is heterozygous Aa. A. What is the probability that the a allele will become fixed in the population via genetic drift? B. If f

> Explain why the glucocorticoid receptor binds next to the core promoter of some genes, but not next to the core promoter of most genes.

> Why is G. tetrahit reproductively isolated from the other two species?

> Why is genetic drift more significant in small populations? Why does it take longer for genetic drift to cause allele fixation in large populations than in small ones?

> For the term genetic drift, what is drifting? Why is this an appropriate term to describe this phenomenon?

> Is each of the following examples due to directional, disruptive, balancing, or stabilizing selection? A. Polymorphisms in snail color and banding pattern as described in Figure 27.12 B. Thick fur among mammals exposed to cold climates C. Birth weight

> Describe the similarities and differences among directional, balancing, disruptive, and stabilizing selection.

> What is the intuitive meaning of the mean fitness of a population? How does its value change in response to natural selection?

> What is Darwinian fitness? What types of characteristics can promote high fitness values? Give several examples.

> What is the difference between a neutral and an adaptive evolutionary process? Describe two or more examples of each. At the molecular level, explain how mutations can be neutral or adaptive.

> What evolutionary factors can cause allele frequencies to change and possibly lead to a genetic polymorphism? Discuss the relative importance of each type of process.

> What is the gene pool? How is a gene pool described in a quantitative way?

> Gradients of morphogens can be preestablished in the oocyte. Also, later in development, morphogens can be secreted from cells. How are these two processes similar and different?

> When an activator protein interacts with mediator, how does this affect the function of RNA polymerase?

> What is positional information? Discuss three different ways that cells obtain positional information. Which of these three ways do you think is the most important for the formation of a segmented body pattern in Drosophila?

> Explain what a morphogen is, and describe how it exerts its effects. What do you expect will happen when a morphogen is expressed in the wrong place in an embryo? List five examples of morphogens that function in Drosophila.

> Here are schematic diagrams of mutant Drosophila larvae. The left side of each pair shows a wild-type larva, with gray boxes showing the sections that are missing in the mutant larva. Which type of gene is defective in each larva: a gap gene, a pair-rul

> Discuss the morphological differences between the parasegments and segments of Drosophila. Discuss the evidence, providing specific examples, that suggests the parasegments of the embryo are the subdivisions for the organization of gene expression.

> Which of the following statement(s) is/are true with regard to positional information in Drosophila? A. Morphogens are a type of molecule that conveys positional information. B. Morphogenetic gradients are established only in the oocyte, prior to ferti

> If you observed fruit flies with the following developmental abnormalities, would you guess that a mutation has occurred in a segmentation gene or a homeotic gene? Explain your guess. A. Three abdominal segments were missing. B. One abdominal segment h

> Discuss the morphological differences between animal and plant development. How are the developmental processes different at the cellular level? How are they similar at the genetic level?

> What is a meristem? Explain the role of meristems in plant development.

> What is a totipotent cell? In each of the following types of organisms, which cells are totipotent? A. Humans B. Corn C. Yeast D. Bacteria

> The MyoD gene in mammals plays a role in skeletal muscle-cell differentiation, whereas the Hox genes are homeotic genes that play a role in the differentiation of particular regions of the body. Explain how the functions of these genes are similar and di

> If a repressor prevents TFIID from binding to the TATA box, why does this inhibit transcription?

> What is cell differentiation? Discuss the role of myogenic bHLH proteins in the differentiation of muscle cells. Explain how they work at the molecular level. In your answer, explain how protein dimerization is key to gene regulation.

> Discuss the similarities and differences between the bithorax and Antennapedia complexes in Drosophila and the Hox gene complexes in mice.

> What is a heterochronic mutation? How does it affect the phenotypic outcome of an organism? What phenotypic effects would you expect if a heterochronic mutation affected the cell lineage that determines the fates of intestinal cells?

> A hypothetical cell lineage is shown here. A gene, which we will call gene X, is activated in the B-1 cell, so the B-1 cell will progress through the proper developmental stages to produce three nerve cells (D-1, D-2, and D-3) and one muscle cell (D-4).

> Cloning of mammals (such as Dolly the sheep) is described in Chapter 22. Based on your understanding of animal development, explain why an enucleated egg is needed to clone mammals. In other words, what features of the oocyte are essential for animal dev

> The arrangement of body axes of the fruit fly are shown in Figure 26.5g. Are the following statements true or false with regard to body axes in the mouse? A. Along the anteroposterior axis, the head is posterior to the tail. B.

> What is the difference between a maternal-effect gene and a zygotic gene? Of the following genes that play a role in Drosophila development, which are maternal-effect genes and which are zygotic? Explain your answer. A. nanos B. Antp C. bicoid D. lab

> Explain how loss-of-function mutations in the following categories of genes would affect the morphologies of Drosophila larvae: A. Gap genes B. Pair-rule genes C. Segment-polarity genes

> If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a loss-of-function or a gain-of function mutation? Explain your answer. A. An abdominal segment has antennae attached to it. B. The most anterior abdominal se

> Based on the photographs in Figure 26.13, in which segments is the Antp gene normally expressed? From Figure 26.13: (a) Normal fly (b) Antennapedia mutant

> Explain how an α helix in a transcription factor protein is able to function as a recognition helix.

> What would you predict to be the phenotype of a Drosophila larva whose mother was homozygous for a loss-of-function allele in the nanos gene?

> Describe the molecular features of the homeobox and homeodomain. Explain how these features are important in the function of homeotic genes.

> Discuss the role of homeotic genes in development. Explain what happens to the phenotype of a fruit fly when a gain-of-function mutation in a homeotic gene causes the protein to be expressed in an abnormal region of the embryo. What are the consequences

> With regard to development, what are the roles of the maternal effect genes versus the zygotic genes? Which types of genes are needed earlier in the development process?

> Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.

> Discuss how the anterior portion of the anteroposterior axis is established in Drosophila. What aspects of oogenesis are critical in establishing this axis? What do you think would happen if the bicoid mRNA was not trapped at the anterior end but instead

> What four types of cellular processes must occur to enable a fertilized egg to develop into an adult multicellular animal? Briefly discuss the role of each process.

> Explain the difference between gene modification and gene addition. Are the following examples of gene modification or gene addition? A. A mouse model to study cystic fibrosis B. Introduction of a pesticide-resistance gene into corn using the T-DNA vec