All Related Questions of Genetics

Q: Which disease occurs when homogentisic acid oxidase is defective?

Which disease occurs when homogentisic acid oxidase is defective?

Q: Explain how mRNA plays a role in all three stages of translation

Explain how mRNA plays a role in all three stages of translation.

Q: What are the functions of relaxase, coupling factor, and the

What are the functions of relaxase, coupling factor, and the exporter in the process of conjugation?

Q: How is an F′ factor different from an F factor?

How is an F′ factor different from an F factor?

Q: With regard to the timing of conjugation, explain why the recipient

With regard to the timing of conjugation, explain why the recipient cell at the top right is pro−, whereas the recipient cell in the bottom right is pro+.

Q: Why is the scale of this map in minutes?

Why is the scale of this map in minutes?

Q: Which of these two genes is closer to the origin of transfer

Which of these two genes is closer to the origin of transfer?

Q: Transduction is sometimes described as a mistake in the bacteriophage reproductive cycle

Transduction is sometimes described as a mistake in the bacteriophage reproductive cycle. Explain how it can be viewed as a mistake.

Q: Why is it useful to stain chromosomes?

Why is it useful to stain chromosomes?

Q: Which of these changes in chromosome structure alter the total amount of

Which of these changes in chromosome structure alter the total amount of genetic material?

Q: Why is a chromosomal fragment without a centromere subsequently lost and degraded

Why is a chromosomal fragment without a centromere subsequently lost and degraded?

Q: In this example, what is the underlying cause of nonallelic homologous

In this example, what is the underlying cause of nonallelic homologous recombination?

Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit

Why does a bacterial mRNA bind specifically to the small ribosomal subunit?

Q: Explain why these homologous chromosomes can synapse only if an inversion loop

Explain why these homologous chromosomes can synapse only if an inversion loop forms.

Q: Which of these two mechanisms might be promoted by the presence of

Which of these two mechanisms might be promoted by the presence of the same transposable element in many places in a species’ genome?

Q: If these segregation patterns are equally likely, what is the probability

If these segregation patterns are equally likely, what is the probability that a gamete produced by the individual who carries the translocated chromosome will result in a viable offspring with a norm...

Q: Explain why these chromosomes form a translocation cross during prophase of meiosis

Explain why these chromosomes form a translocation cross during prophase of meiosis I.

Q: What adjectives can be used to describe a fruit fly that has

What adjectives can be used to describe a fruit fly that has a total of seven chromosomes because it is missing one copy of chromosome 3?

Q: Explain why the mouse in part (d) died.

Explain why the mouse in part (d) died.

Q: Describe the imbalance in gene products that occurs in an individual with

Describe the imbalance in gene products that occurs in an individual with monosomy 2.

Q: Approximately how many copies of chromosome 2 are found in a polytene

Approximately how many copies of chromosome 2 are found in a polytene chromosome in Drosophila?

Q: What are some common advantages of polyploidy in plants?

What are some common advantages of polyploidy in plants?

Q: Explain why a triploid individual is usually infertile.

Explain why a triploid individual is usually infertile.

Q: What is the role of peptidyl transferase during the elongation stage?

What is the role of peptidyl transferase during the elongation stage?

Q: What was the purpose of adding RNase or protease to a DNA

What was the purpose of adding RNase or protease to a DNA extract?

Q: Which of these components of nucleotides are not found in DNA?

Which of these components of nucleotides are not found in DNA?

Q: Which components of nucleotides form the backbone of a DNA strand?

Which components of nucleotides form the backbone of a DNA strand?

Q: What holds the DNA strands together?

What holds the DNA strands together?

Q: Describe the major and minor grooves.

Describe the major and minor grooves.

Q: What are the structural differences between B DNA and Z DNA?

What are the structural differences between B DNA and Z DNA?

Q: What types of bonds hold nucleotides together in an RNA strand?

What types of bonds hold nucleotides together in an RNA strand?

Q: What are the base-pairing rules for RNA?

What are the base-pairing rules for RNA?

Q: What types of sequences constitute most of a bacterial genome?

What types of sequences constitute most of a bacterial genome?

Q: What is a chromosome territory?

What is a chromosome territory?

Q: Explain why release factors are called “molecular mimics”.

Explain why release factors are called “molecular mimics”.

Q: Would you expect to find active genes in regions of heterochromatin or

Would you expect to find active genes in regions of heterochromatin or euchromatin?

Q: How many nucleoids are in this bacterial cell? /

How many nucleoids are in this bacterial cell?

Q: Why is strand separation beneficial?

Why is strand separation beneficial?

Q: In your own words, describe the step that requires the use

In your own words, describe the step that requires the use of ATP.

Q: What are some differences between the types of sequences found in eukaryotic

What are some differences between the types of sequences found in eukaryotic chromosomes versus bacterial chromosomes?

Q: What are two reasons for the wide variation in genome sizes among

What are two reasons for the wide variation in genome sizes among eukaryotic species?

Q: What is the diameter of a nucleosome?

What is the diameter of a nucleosome?

Q: Describe the distinguishing features of the solenoid and zigzag models.

Describe the distinguishing features of the solenoid and zigzag models.

Q: What is the function of the nuclear matrix?

What is the function of the nuclear matrix?

Q: What features of the structure of DNA enable it to be replicated

What features of the structure of DNA enable it to be replicated?

Q: What is a functional consequence of RNA editing?

What is a functional consequence of RNA editing?

Q: Why do eukaryotes need multiple origins of replication?

Why do eukaryotes need multiple origins of replication?

Q: How many times would telomerase have to bind to a different site

How many times would telomerase have to bind to a different site in the telomere to make a segment of DNA that is 36 nucleotides in length?

Q: Describe what structural changes convert a chromosomal region that is 300 nm

Describe what structural changes convert a chromosomal region that is 300 nm in diameter to one that is 700 nm in diameter.

Q: Describe what happens to cohesin from the beginning of prophase through anaphase

Describe what happens to cohesin from the beginning of prophase through anaphase.

Q: Explain what the word nondisjunction means.

Explain what the word nondisjunction means.

Q: What are the functions of the AT-rich region and DnaA

What are the functions of the AT-rich region and DnaA boxes?

Q: How many replication forks are formed at the origin?

How many replication forks are formed at the origin?

Q: Look ahead to Figure 11.9. Why is primase needed

Look ahead to Figure 11.9. Why is primase needed for DNA replication? From Figure 11.9:

Q: Is the template strand read in the 5′ to 3′

Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?

Q: Describe the differences in the synthesis of the leading and lagging strands

Describe the differences in the synthesis of the leading and lagging strands

Q: What is the key difference between autopolyploidy and allopolyploidy?

What is the key difference between autopolyploidy and allopolyploidy?

Q: What is the advantage of having the replication machinery in a complex

What is the advantage of having the replication machinery in a complex?

Q: Is DNA strand breakage necessary for catenane separation?

Is DNA strand breakage necessary for catenane separation?

Q: Does the oxygen in the newly made ester bond come from the

Does the oxygen in the newly made ester bond come from the phosphate or from the sugar?

Q: If a mutation changed the start codon into a stop codon,

If a mutation changed the start codon into a stop codon, would this mutation affect the length of the RNA? Explain.

Q: Which of these three mechanisms is very common in eukaryotes?

Which of these three mechanisms is very common in eukaryotes?

Q: Describe the roles of snRNPs in the splicing process.

Describe the roles of snRNPs in the splicing process.

Q: A pre-mRNA with 7 exons and 6 introns is recognized

A pre-mRNA with 7 exons and 6 introns is recognized by just one splicing repressor that binds to the 3´ end of the third intron. The third intron is located between exon 3 and exon 4. After splicing i...

Q: What are three functional roles of the 7-methlyguanosine cap?

What are three functional roles of the 7-methlyguanosine cap?

Q: What does the term consensus sequence mean?

What does the term consensus sequence mean?

Q: Why is it necessary for portions of σ-factor protein to

Why is it necessary for portions of σ-factor protein to fit into the major groove?

Q: What do the terms epistasis and complementation mean?

What do the terms epistasis and complementation mean?

Q: What feature of the –10 sequence makes it easy to unwind

What feature of the –10 sequence makes it easy to unwind?

Q: What would be the consequences if a mutation removed the rut site

What would be the consequences if a mutation removed the rut site from this RNA molecule?

Q: Why is NusA important for this termination process?

Why is NusA important for this termination process?

Q: What is the functional role of the TATA box?

What is the functional role of the TATA box?

Q: Why is carboxyl terminal domain (CTD) phosphorylation functionally important?

Why is carboxyl terminal domain (CTD) phosphorylation functionally important?

Q: What is the difference between an endonuclease and an exonuclease?

What is the difference between an endonuclease and an exonuclease?

Q: What is mitotic recombination? A heterozygous individual (Bb) with

What is mitotic recombination? A heterozygous individual (Bb) with brown eyes has one eye with a small patch of blue. Provide two or more explanations for how the blue patch may have occurred.

Q: Mitotic recombination can occasionally produce a twin spot. Let’s suppose an

Mitotic recombination can occasionally produce a twin spot. Let’s suppose an animal species is heterozygous for two genes that govern fur color and length: one gene affects pigmentation, with dark pig...

Q: A crossover has occurred in the bivalent shown here. /

A crossover has occurred in the bivalent shown here. If a second crossover occurs in the same region between these two genes, which two chromatids would be involved to produce the following outcomes?...

Q: A crossover has occurred in the bivalent shown here /

A crossover has occurred in the bivalent shown here What is the outcome of this single crossover event? If a second crossover occurs somewhere between A and C, explain which two chromatids it would i...

Q: Explain why a single gene knockout does not always have an effect

Explain why a single gene knockout does not always have an effect on the phenotype.

Q: A diploid organism has a total of 14 chromosomes and about 20

A diploid organism has a total of 14 chromosomes and about 20,000 genes per haploid genome. Approximately how many genes are in each linkage group?

Q: If you try to throw a basketball into a basket, the

If you try to throw a basketball into a basket, the likelihood of succeeding depends on the size of the basket. It is more likely that you will get the ball into the basket if the basket is bigger. In...

Q: By conducting testcrosses, researchers have found that the sweet pea has

By conducting testcrosses, researchers have found that the sweet pea has seven linkage groups. How many chromosomes would you expect to find in leaf cells of the plants?

Q: The terms conjugation, transduction, and transformation are used to describe

The terms conjugation, transduction, and transformation are used to describe three different natural forms of genetic transfer between bacterial cells. Briefly discuss the similarities and differences...

Q: What is cotransduction? What determines the likelihood that two genes will

What is cotransduction? What determines the likelihood that two genes will be cotransduced?

Q: When bacteriophage P1 causes E. coli to lyse, the resulting

When bacteriophage P1 causes E. coli to lyse, the resulting material is called a P1 lysate. What type of genetic material would be found in most of the P1 phages in the lysate? What kind of genetic ma...

Q: As described in Figure 7.10, host DNA is hydrolyzed

As described in Figure 7.10, host DNA is hydrolyzed into small pieces, which are occasionally assembled with phage proteins, creating a phage with bacterial chromosomal DNA. If the breakage of the chr...

Q: Describe the steps that occur during bacterial transformation. What is a

Describe the steps that occur during bacterial transformation. What is a competent cell? What factors may determine whether a cell will be competent?

Q: Which bacterial genetic transfer process does not require recombination with the bacterial

Which bacterial genetic transfer process does not require recombination with the bacterial chromosome?

Q: Researchers who study the molecular mechanism of transformation have identified many proteins

Researchers who study the molecular mechanism of transformation have identified many proteins in bacteria that function in the uptake of DNA from the environment and its recombination into the host ce...

Q: At the molecular level (with regard to loss-of-

At the molecular level (with regard to loss-of-function alleles), explain why the ttvv homozygote has an ovate seed capsule.

Q: Antibiotics such as tetracycline, streptomycin, and bacitracin are small organic

Antibiotics such as tetracycline, streptomycin, and bacitracin are small organic molecules that are synthesized by particular species of bacteria. Microbiologists have hypothesized that the reason why...

Q: Certain forms of human color blindness are inherited as X-linked

Certain forms of human color blindness are inherited as X-linked recessive traits. Hemizygous males are color-blind, but heterozygous females are not. However, heterozygous females sometimes have part...

Q: A black female cat (XB XB ) and an orange male

A black female cat (XB XB ) and an orange male cat (X0 Y) were mated to each other and produced a male cat that was calico. Which sex chromosomes did this male offspring inherit from its mother and fa...

Q: What is the spreading phase of X-chromosome inactivation? Why

What is the spreading phase of X-chromosome inactivation? Why do you think it is called a spreading phase? 

Q: Conjugation is sometimes called bacterial mating. Is it a form of

Conjugation is sometimes called bacterial mating. Is it a form of sexual reproduction? Explain.

Q: When does the erasure and reestablishment phase of genomic imprinting occur?

When does the erasure and reestablishment phase of genomic imprinting occur? Explain why it is necessary to erase an imprint and then reestablish it in order to always maintain imprinting from the sam...

Q: In what types of cells would you expect de novo methylation to

In what types of cells would you expect de novo methylation to occur? In what cell types would it not occur?

Q: On rare occasions, people are born with a condition known as

On rare occasions, people are born with a condition known as uniparental disomy. It happens when an individual inherits both copies of a chromosome from one parent and no copies from the other parent....

Q: Genes that cause Prader-Willi syndrome and Angelman syndrome are closely

Genes that cause Prader-Willi syndrome and Angelman syndrome are closely linked along chromosome 15. Although people with these syndromes do not usually reproduce, let’s suppose that a couple produces...

Q: How is the process of X-chromosome inactivation similar to genomic

How is the process of X-chromosome inactivation similar to genomic imprinting? How is it different?

Q: Which butterfly has a more active pigment-producing enzyme, the

Which butterfly has a more active pigment-producing enzyme, the dark- or light-colored one? From Figure 1.7c:

Q: What is extranuclear inheritance? Describe three examples.

What is extranuclear inheritance? Describe three examples.

Q: What is a reciprocal cross? Suppose that a gene is found

What is a reciprocal cross? Suppose that a gene is found as a wildtype (functional) allele and a recessive mutant (nonfunctional) allele. What would be the expected outcomes of reciprocal crosses if a...

Q: Among different species, does extranuclear inheritance always follow a maternal inheritance

Among different species, does extranuclear inheritance always follow a maternal inheritance pattern? Why or why not?

Q: Extranuclear inheritance often correlates with maternal inheritance. Even so, paternal

Extranuclear inheritance often correlates with maternal inheritance. Even so, paternal leakage may occur. What is paternal leakage? If a cross produced 200 offspring and the rate of mitochondrial pate...

Q: Discuss the structure and organization of the mitochondrial and chloroplast genomes.

Discuss the structure and organization of the mitochondrial and chloroplast genomes. How large are they, how many genes do they contain, and how many copies of the genome are found in each organelle?...

Q: If you mix together an equal number of F+ and F

If you mix together an equal number of F+ and F− cells, how would you expect the proportions to change over time? In other words, do you expect an increase in the relative proportion of F+ or of F− ce...

Q: Explain the likely evolutionary origin of mitochondrial and chloroplast genomes. How

Explain the likely evolutionary origin of mitochondrial and chloroplast genomes. How have the sizes of the mitochondrial and chloroplast genomes changed since their origin? How has this occurred?

Q: Which of the following traits or diseases is(are) determined

Which of the following traits or diseases is(are) determined by nuclear genes? A. Snail coiling pattern B. Prader-Willi syndrome C. Leber hereditary optic neuropathy

Q: Acute murine leukemia virus (AMLV) causes leukemia in mice.

Acute murine leukemia virus (AMLV) causes leukemia in mice. This virus is easily passed from mother to offspring through the mother’s milk. (Note: Even though newborn offspring acquire the virus, they...

Q: Describe how a biparental pattern of extranuclear inheritance would resemble a Mendelian

Describe how a biparental pattern of extranuclear inheritance would resemble a Mendelian pattern of inheritance for a particular gene. How would they differ?

Q: What enzymatic function is missing in the strain 2 mutants?

What enzymatic function is missing in the strain 2 mutants?

Q: Why do these two frogs look so different? From

Why do these two frogs look so different? From Figure 1.8:

Q: A woman with achondroplasia (a dominant form of dwarfism) and

A woman with achondroplasia (a dominant form of dwarfism) and a phenotypically unaffected man have seven children, all of whom have achondroplasia. What is the probability of producing such a family i...

Q: Pick any example of a genetic technology and describe how it has

Pick any example of a genetic technology and describe how it has directly affected your life.

Q: What is a DNA sequence?

What is a DNA sequence?

Q: What is the genetic code?

What is the genetic code?

Q: Explain the relationship between each of the following pairs of genetic terms

Explain the relationship between each of the following pairs of genetic terms: A. Gene and trait B. Gene and chromosome C. Allele and gene D. DNA sequence and amino acid sequence

Q: With regard to biological evolution, which of the following statements is

With regard to biological evolution, which of the following statements is incorrect? Explain why. A. During its lifetime, an animal evolves to become better adapted to its environment. B. The proces...

Q: What is the difference between an F+ and an Hfr strain

What is the difference between an F+ and an Hfr strain? Which type of strain do you expect to transfer many bacterial genes to recipient cells?

Q: What are the primary interests of researchers working in the following fields

What are the primary interests of researchers working in the following fields of genetics? A. Transmission genetics B. Molecular genetics C. Population genetics

Q: At the molecular level, what is a gene? Where are

At the molecular level, what is a gene? Where are genes located?

Q: Most genes encode proteins. Explain how the structure and function of

Most genes encode proteins. Explain how the structure and function of proteins produce an organism’s traits.

Q: Prior to fertilization, where is the male gamete located?

Prior to fertilization, where is the male gamete located?

Q: What is the role of the origin of transfer during F+-

What is the role of the origin of transfer during F+- and Hfr mediated conjugation? What is the significance of the direction of transfer in Hfr-mediated conjugation?

Q: What is the role of sex pili during conjugation?

What is the role of sex pili during conjugation?

Q: Think about the structure and transmission of F factors and discuss how

Think about the structure and transmission of F factors and discuss how you think F factors may have originated.

Q: Each species of bacteria has its own distinctive cell surface. The

Each species of bacteria has its own distinctive cell surface. The characteristics of the cell surface play an important role in processes such as conjugation and transduction. For example, certain st...

Q: Briefly describe the lytic and lysogenic cycles of bacteriophages. In your

Briefly describe the lytic and lysogenic cycles of bacteriophages. In your answer, explain what a prophage is.

Q: Which changes in chromosome structure cause a change in the total amount

Which changes in chromosome structure cause a change in the total amount of genetic material, and which do not?

Q: An individual has the following reciprocal translocation: /

An individual has the following reciprocal translocation: What would be the outcome of alternate segregation and of adjacent-1 segregation?

Q: A phenotypically normal individual has the following combinations of normal and abnormal

A phenotypically normal individual has the following combinations of normal and abnormal chromosomes: The normal chromosomes are shown on the left in each pair. Suggest a series of events (breaks, tr...

Q: Two phenotypically normal parents produce a phenotypically abnormal child in which chromosome

Two phenotypically normal parents produce a phenotypically abnormal child in which chromosome 5 is missing part of its long arm but has a piece of chromosome 7 attached to it. The child also has one n...

Q: With regard to the segregation of centromeres, why is adjacent-

With regard to the segregation of centromeres, why is adjacent-2 segregation less frequent than alternate or adjacent-1 segregation?

Q: The leaf cells of a corn plant contain 20 chromosomes each.

The leaf cells of a corn plant contain 20 chromosomes each. How many chromosomes are found in a gamete made by a corn plant?

Q: Which of the following types of chromosomal changes would you expect to

Which of the following types of chromosomal changes would you expect to have phenotypic consequences? Explain your choices. A. Pericentric inversion B. Reciprocal translocation C. Deletion D. Unba...

Q: Explain why a translocation cross occurs during metaphase of meiosis I when

Explain why a translocation cross occurs during metaphase of meiosis I when a cell contains a reciprocal translocation.

Q: A phenotypically abnormal individual has a phenotypically normal father with an inversion

A phenotypically abnormal individual has a phenotypically normal father with an inversion on one copy of chromosome 7 and a phenotypically normal mother without any changes in chromosome structure. Th...

Q: A diploid fruit fly has eight chromosomes. How many total chromosomes

A diploid fruit fly has eight chromosomes. How many total chromosomes would be found in the following flies? A. Tetraploid B. Trisomy 2 C. Monosomy 3 D. 3n E. 4n + 1

Q: A person is born with one X chromosome, zero Y chromosomes

A person is born with one X chromosome, zero Y chromosomes, trisomy 21, and two copies of the other chromosomes. How many chromosomes does this person have altogether? Explain whether this person is e...

Q: Two phenotypically unaffected parents produce two children with familial Down syndrome.

Two phenotypically unaffected parents produce two children with familial Down syndrome. With regard to chromosomes 14 and 21, what are the chromosomal compositions of the parents?

Q: Explain why small deletions and duplications are less likely to have a

Explain why small deletions and duplications are less likely to have a detrimental effect on an individual’s phenotype than large ones. If a small deletion within a single chromosome happens to have a...

Q: Aneuploidy is typically detrimental, whereas polyploidy is sometimes beneficial, particularly

Aneuploidy is typically detrimental, whereas polyploidy is sometimes beneficial, particularly in plants. Discuss why you think this is the case.

Q: Explain how aneuploidy, deletions, and duplications cause genetic imbalances.

Explain how aneuploidy, deletions, and duplications cause genetic imbalances. Why do you think that deletions and monosomies are more detrimental than duplications and trisomies?

Q: Female fruit flies homozygous for the X-linked white-eye

Female fruit flies homozygous for the X-linked white-eye allele are crossed to males with red eyes. On very rare occasions, an offspring of such a cross is a male with red eyes. Assuming these rare of...

Q: According to the theory of evolution, why have these changes occurred

According to the theory of evolution, why have these changes occurred in horse populations over the course of many generations? From Figure 1.11:

Q: A cytogeneticist has collected tissue samples from members of a certain butterfly

A cytogeneticist has collected tissue samples from members of a certain butterfly species. Some of the butterflies were located in Canada, and others were found in Mexico. Through karyotyping, the cyt...

Q: Why do you think that humans with trisomy chromosome 13, 18

Why do you think that humans with trisomy chromosome 13, 18, or 21 can survive but other trisomies are lethal? Even though X chromosomes are large, aneuploidy of this chromosome is also tolerated. Exp...

Q: A zookeeper has collected a male and a female lizard that look

A zookeeper has collected a male and a female lizard that look like they belong to the same species. They mate with each other and produce phenotypically normal offspring. However, the offspring are s...

Q: What is endopolyploidy? What is its biological significance?

What is endopolyploidy? What is its biological significance?

Q: What is mosaicism? How is it produced?

What is mosaicism? How is it produced?

Q: Explain how polytene chromosomes of Drosophila are produced and how they form

Explain how polytene chromosomes of Drosophila are produced and how they form a six-armed structure.

Q: Describe some of the advantages of polyploid plants. What are the

Describe some of the advantages of polyploid plants. What are the consequences of having an odd number of chromosome sets?

Q: How does a chromosomal duplication occur?

How does a chromosomal duplication occur?

Q: While conducting field studies on a chain of islands, you decide

While conducting field studies on a chain of islands, you decide to karyotype two phenotypically identical groups of turtles, which are found on different islands. The turtles on one island have 24 ch...

Q: A diploid fruit fly has eight chromosomes. Which of the following

A diploid fruit fly has eight chromosomes. Which of the following terms should not be used to describe a fruit fly with four sets of chromosomes? A. Polyploid B. Aneuploid C. Euploid D. Tetraploid...

Q: Can you think of another example of a model organism?

Can you think of another example of a model organism?

Q: Which of the following terms should not be used to describe a

Which of the following terms should not be used to describe a human with three copies of chromosome 12? A. Polyploid B. Triploid C. Aneuploid D. Euploid E. 2n + 1 F. Trisomy 12

Q: The kidney bean plant, Phaseolus vulgaris, is a diploid species

The kidney bean plant, Phaseolus vulgaris, is a diploid species containing a total of 22 chromosomes in somatic cells. How many possible types of trisomic individuals could be produced in this species...

Q: The karyotype of a young girl who is affected with familial Down

The karyotype of a young girl who is affected with familial Down syndrome revealed a total of 46 chromosomes. Her older brother, however, who is phenotypically unaffected, actually had 45 chromosomes....

Q: A triploid plant has 18 chromosomes (i.e., 6

A triploid plant has 18 chromosomes (i.e., 6 chromosomes per set). If we assume a gamete has an equal probability of receiving one or two copies of each of the six types of chromosome, what are the od...

Q: What is a gene family? How are gene families produced over

What is a gene family? How are gene families produced over time? With regard to gene function, what is the biological significance of a gene family?

Q: Following a gene duplication, two genes will accumulate different mutations,

Following a gene duplication, two genes will accumulate different mutations, causing them to have slightly different sequences. In Figure 8.7, which pair of genes would you expect to have more similar...

Q: Two chromosomes have the following orders for their genes: Normal

Two chromosomes have the following orders for their genes: Normal: A B C centromere D E F G H I Abnormal: A B G F E D centromere C H I Does the abnormal chromosome have a pericentric or a paracentr...

Q: An inversion heterozygote has the following inverted chromosome: /

An inversion heterozygote has the following inverted chromosome: What would be the products if a crossover occurred between genes H and I on the inverted chromosome and a normal chromosome?

Q: An inversion heterozygote has the following inverted chromosome: /

An inversion heterozygote has the following inverted chromosome: What would be the products if a crossover occurred between genes H and I on the inverted chromosome and a normal chromosome?

Q: Explain why inversions and reciprocal translocations do not usually cause a phenotypic

Explain why inversions and reciprocal translocations do not usually cause a phenotypic effect. In a few cases, however, they do. Explain how.

Q: How might a better understanding of our genes be used in the

How might a better understanding of our genes be used in the field of medicine?

Q: What is the meaning of the term genetic material?

What is the meaning of the term genetic material?

Q: Make a side-by-side drawing of two DNA helices

Make a side-by-side drawing of two DNA helices: one with 10 bp per 360° turn and the other with 15 bp per 360° turn.

Q: Discuss the differences in the structural features of B DNA and Z

Discuss the differences in the structural features of B DNA and Z DNA.

Q: What part(s) of a nucleotide (namely, phosphate

What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is(are) found in the major and minor grooves of doublestranded DNA, and what part(s) is(are) found in the DNA backbone? If a DNA-bi...

Q: List the structural differences between DNA and RNA.

List the structural differences between DNA and RNA.

Q: Draw the structure of deoxyribose and number the carbon atoms. Describe

Draw the structure of deoxyribose and number the carbon atoms. Describe the numbering of the carbon atoms in deoxyribose with regard to the directionality of a DNA strand. In a DNA double helix, what...

Q: Write a sequence of an RNA molecule that could form a stem

Write a sequence of an RNA molecule that could form a stem-loop with 24 nucleotides in the stem and 16 nucleotides in the loop.

Q: Compare the structural features of a double-stranded RNA structure with

Compare the structural features of a double-stranded RNA structure with those of a DNA double helix.

Q: Which of the following DNA double helices would be more difficult to

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat, which breaks hydrogen bonds? A. GGCGTACCAGCGCAT CCGCATGGTCGCGTA...

Q: What structural feature allows DNA to store information?

What structural feature allows DNA to store information?

Q: What ethical issues may be associated with human cloning?

What ethical issues may be associated with human cloning?

Q: Discuss the structural significance of complementarity in DNA and in RNA.

Discuss the structural significance of complementarity in DNA and in RNA.

Q: After the DNA from type S bacteria is exposed to type R

After the DNA from type S bacteria is exposed to type R bacteria, list all of the steps that you think must occur for the type R bacteria to start making a capsule.

Q: An organism has a G + C content of 64% in

An organism has a G + C content of 64% in its DNA. What are the percentages of A, T, G, and C?

Q: Let’s suppose you have recently identified an organism that was scraped from

Let’s suppose you have recently identified an organism that was scraped from an asteroid that hit the earth. (Fortunately, no one was injured.) When you analyze this organism, you discover that its DN...

Q: On further analysis of the DNA described in conceptual question C21,

On further analysis of the DNA described in conceptual question C21, you discover that the triplex DNA in this alien organism is composed of a double helix with a third strand wound within the major g...

Q: A DNA-binding protein recognizes the following double-stranded sequence

A DNA-binding protein recognizes the following double-stranded sequence: 5′–GCCCGGGC–3′ 3′–CGGGCCCG–5′ This type of double-stranded structure could also occur within the stem region of an RNA stem-lo...

Q: Within a protein, certain amino acids are positively charged (e

Within a protein, certain amino acids are positively charged (e.g., lysine and arginine), some are negatively charged (e.g., glutamate and aspartate), some are polar but uncharged, and some are nonpol...

Q: Look up the meaning of the word transformation in a dictionary and

Look up the meaning of the word transformation in a dictionary and explain whether it is an appropriate word to describe the transfer of genetic material from one organism to another.

Q: What are the building blocks of a nucleotide? With regard to

What are the building blocks of a nucleotide? With regard to the 5′ and 3′ positions on a sugar molecule, how are nucleotides linked together to form a strand of DNA?

Q: Draw the structures of guanine, guanosine, and deoxyguanosine triphosphate

Draw the structures of guanine, guanosine, and deoxyguanosine triphosphate

Q: Why is it useful to sort male mosquitoes from females?

Why is it useful to sort male mosquitoes from females?

Q: Draw the structure of a phosphodiester linkage.

Draw the structure of a phosphodiester linkage.

Q: Describe how bases interact with each other in the double helix.

Describe how bases interact with each other in the double helix. This description should include the concepts of complementarity, hydrogen bonding, and base stacking.

Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what

If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?

Q: What is meant by the term DNA sequence?

What is meant by the term DNA sequence?

Q: What is a bacterial nucleoid? With regard to cellular membranes,

What is a bacterial nucleoid? With regard to cellular membranes, what is the difference between a bacterial nucleoid and a eukaryotic nucleus?

Q: What is the function of a centromere? At what stage of

What is the function of a centromere? At what stage of the cell cycle would you expect the centromere to be the most important?

Q: Describe the characteristics of highly repetitive DNA sequences.

Describe the characteristics of highly repetitive DNA sequences.

Q: Describe the structures of a nucleosome and a 30-nm fiber

Describe the structures of a nucleosome and a 30-nm fiber

Q: Beginning with the G1 phase of the cell cycle, describe the

Beginning with the G1 phase of the cell cycle, describe the level of compaction of the eukaryotic chromosome. How does the level of compaction change as the cell progresses through the cell cycle? Why...

Q: Draw a picture depicting the binding between the nuclear matrix and a

Draw a picture depicting the binding between the nuclear matrix and a MAR.

Q: Is DNA a small molecule, a macromolecule, or an organelle

Is DNA a small molecule, a macromolecule, or an organelle?

Q: Compare heterochromatin and euchromatin. What are the differences between them?

Compare heterochromatin and euchromatin. What are the differences between them?

Q: Compare the structure and cell localization of chromosomes during interphase and M

Compare the structure and cell localization of chromosomes during interphase and M phase

Q: What types of genetic activities occur during interphase? Explain why these

What types of genetic activities occur during interphase? Explain why these activities cannot occur during M phase.

Q: Let’s assume the linker region of DNA averages 54 bp in length

Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?

Q: In Figure 10.12, what are we looking at in

In Figure 10.12, what are we looking at in part (b)? Is this an 11-nm fiber, a 30-nm fiber, or a 300-nm fiber? Does this DNA come from a cell during M phase or interphase? From Figure 10.12b:

Q: In Part II of this text, we considered inheritance patterns for

In Part II of this text, we considered inheritance patterns for diploid eukaryotic species. Bacteria frequently contain two or more nucleoids. With regard to genes and alleles, how is a bacterium that...

Q: What are the roles of the core histone proteins and of histone

What are the roles of the core histone proteins and of histone H1 in the compaction of eukaryotic DNA?

Q: A typical eukaryotic chromosome found in humans contains about 100 million bp

A typical eukaryotic chromosome found in humans contains about 100 million bp. As noted in Chapter 9, one DNA base pair has a linear length of 0.34 nm. A. What is the linear length of the DNA in a ty...

Q: Which of the following terms should not be used to describe a

Which of the following terms should not be used to describe a Barr body? A. Chromatin B. Euchromatin C. Heterochromatin D. Chromosome E. Genome

Q: Discuss the differences between the compaction levels of metaphase chromosomes and those

Discuss the differences between the compaction levels of metaphase chromosomes and those of interphase chromosomes. When would you expect gene transcription and DNA replication to take place, during M...

Q: Which types of macromolecules are found in chromosomes?

Which types of macromolecules are found in chromosomes?

Q: What is an SMC complex? Describe two examples.

What is an SMC complex? Describe two examples.

Q: In what ways are the structures of an α helix in a

In what ways are the structures of an α helix in a protein and the double helix of DNA similar, and in what ways are they different?

Q: A double-stranded DNA molecule contains 560 nucleotides. How many

A double-stranded DNA molecule contains 560 nucleotides. How many complete turns occur in this double helix?

Q: As the minor and major grooves wind around a DNA double helix

As the minor and major grooves wind around a DNA double helix, do they ever intersect each other, or do they always run parallel to each other?

Q: What chemical group (phosphate group, hydroxyl group, or a

What chemical group (phosphate group, hydroxyl group, or a nitrogenous base) is found at the 3′ end of a DNA strand? What group is found at the 5′ end?

Q: Describe the mechanisms by which bacterial DNA becomes compacted

Describe the mechanisms by which bacterial DNA becomes compacted

Q: Why is DNA supercoiling called supercoiling rather than just coiling? Why

Why is DNA supercoiling called supercoiling rather than just coiling? Why is positive supercoiling called overwinding and negative supercoiling called underwinding? How would you define the terms posi...

Q: Coumarins and quinolones are two classes of drugs that inhibit bacterial growth

Coumarins and quinolones are two classes of drugs that inhibit bacterial growth by directly inhibiting DNA gyrase. Discuss two reasons why inhibiting DNA gyrase also inhibits bacterial growth.

Q: Take two pieces of string that are approximately 10 inches long,

Take two pieces of string that are approximately 10 inches long, and create a double helix by wrapping them around each other to make 10 complete turns. Tape one end of the strings to a table, and now...

Q: Try to explain the function of DNA gyrase with a drawing.

Try to explain the function of DNA gyrase with a drawing.

Q: Describe the role of DNA in the synthesis of a polypeptide.

Describe the role of DNA in the synthesis of a polypeptide.

Q: In this experiment, which plant, the white- or purple

In this experiment, which plant, the white- or purple flowered one, is providing the egg cells, and which is providing the sperm cells.

Q: How are two topoisomers different from each other? How are they

How are two topoisomers different from each other? How are they the same?

Q: On rare occasions, a chromosome can suffer a small deletion that

On rare occasions, a chromosome can suffer a small deletion that removes the centromere. When this occurs, the chromosome usually is not found within subsequent daughter cells. Explain why a chromosom...

Q: What key structural features of the DNA molecule underlie its ability to

What key structural features of the DNA molecule underlie its ability to be faithfully replicated?

Q: As shown in Figure 11.5, five DnaA boxes are

As shown in Figure 11.5, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully. A. Are the sequences of the five DnaA boxes very similar...

Q: Obtain two strings of different colors (e.g., black

Obtain two strings of different colors (e.g., black and white) that are the same length. A length of 20 inches is sufficient. Tie a knot at one end of the black string and another knot at one end of t...

Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is

Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA strand. With regard to pyrimidines and purines, two general types of mistakes are possible. The addition...

Q: A short genetic sequence, which may be recognized by primase,

A short genetic sequence, which may be recognized by primase, is repeated many times throughout the E. coli chromosome. Researchers have hypothesized that primase may recognize this sequence as a site...

Q: Single-strand binding proteins keep the two parental strands of DNA

Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding protei...

Q: In the following drawing, the top strand is the template DNA

In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA polymerase I. The lagging strand contains three Okazaki fragment...

Q: Describe the three important functions of DnaA protein

Describe the three important functions of DnaA protein

Q: What do we mean when we say a strain is true-

What do we mean when we say a strain is true-breeding?

Q: Draw a picture that illustrates how DNA helicase works.

Draw a picture that illustrates how DNA helicase works.

Q: What is an Okazaki fragment? In which strand of replicating DNA

What is an Okazaki fragment? In which strand of replicating DNA are Okazaki fragments found? Based on the properties of DNA polymerase, why is it necessary to make these fragments?

Q: Discuss the similarities and differences in the synthesis of DNA in the

Discuss the similarities and differences in the synthesis of DNA in the lagging and leading strands. What is the advantage of a primosome and a replisome as opposed to having all replication enzymes f...

Q: With regard to DNA replication, define the term bidirectional replication

With regard to DNA replication, define the term bidirectional replication

Q: Explain the proofreading function of DNA polymerase.

Explain the proofreading function of DNA polymerase.

Q: What is a processive enzyme? Explain why processivity is an important

What is a processive enzyme? Explain why processivity is an important feature of DNA polymerase.

Q: What enzymatic features of DNA polymerase prevent it from replicating one of

What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability...

Q: As shown in Figure 11.24, telomerase attaches additional DNA

As shown in Figure 11.24, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand...

Q: If a eukaryotic chromosome has 25 origins of replication, how many

If a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at the beginning of DNA replication?

Q: In eukaryotes, what is meant by the term DNA replication licensing

In eukaryotes, what is meant by the term DNA replication licensing? How does the process occur?

Q: With regard to the T and t alleles, explain what the

With regard to the T and t alleles, explain what the word segregation means.

Q: A diagram of a linear chromosome is shown here. The end

A diagram of a linear chromosome is shown here. The end of each strand is labeled with A, B, C, or D. Which ends could not be replicated by DNA polymerase? Why not? 5′–A———————————————————B–3′ 3′–C——...

Q: As discussed in Chapter 18, some viruses contain RNA as their

As discussed in Chapter 18, some viruses contain RNA as their genetic material. Certain RNA viruses can exist as a provirus in which the viral genetic material has been inserted into the chromosomal D...

Q: Telomeres contain a 3′ overhang region, as shown in Figure

Telomeres contain a 3′ overhang region, as shown in Figure 11.22. Does telomerase require a 3′ overhang to replicate the telomere region? Explain. From Figure 11.2...

Q: The base composition of an RNA virus was analyzed and found to

The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded R...

Q: Which of the following statements is not true? Explain why.

Which of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly mad...

Q: The genetic material found within some viruses is single-stranded DNA

The genetic material found within some viruses is single-stranded DNA. Would this genetic material contain equal amounts of A and T and equal amounts of G and C?

Q: A medium-sized human chromosome contains about 100 million bp.

A medium-sized human chromosome contains about 100 million bp. If the DNA were stretched out in a linear manner, how long would it be?

Q: A double-stranded DNA molecule is 1 cm long, and

A double-stranded DNA molecule is 1 cm long, and the percentage of adenine in it is 15%. How many cytosines does this DNA molecule contain?

Q: Could single-stranded DNA form a stem-loop structure?

Could single-stranded DNA form a stem-loop structure? Why or why not?

Q: As described in Chapter 15, the methylation of cytosine bases can

As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene expression. For example, the methylation of cytosines may inhibit the transcription of genes. A methy...

Q: According to the linkage hypothesis shown here, what is linked?

According to the linkage hypothesis shown here, what is linked? Are two different genes linked, or are two different alleles of the same gene linked, or both? From Figure 2.7:

Q: An RNA molecule has the following sequence: Parts of region

An RNA molecule has the following sequence: Parts of region 1 can form a stem-loop with region 2 and with region 3. Can region 1 form a stem-loop with region 2 and region 3 at the same time? Why or wh...

Q: Describe three naturally occurring ways that chromosome number can change.

Describe three naturally occurring ways that chromosome number can change.

Q: Meiotic nondisjunction is much more likely than mitotic nondisjunction. Based on

Meiotic nondisjunction is much more likely than mitotic nondisjunction. Based on this observation, would you conclude that meiotic nondisjunction is usually due to nondisjunction during meiosis I or m...

Q: A woman who is heterozygous, Bb, has brown eyes; 

A woman who is heterozygous, Bb, has brown eyes; B (brown) is the dominant allele, and b (blue) is recessive. One of her eyes, however, has a patch of blue color. Give three different explanations for...

Q: The compound known as nitrous acid is a reactive chemical that replaces

The compound known as nitrous acid is a reactive chemical that replaces amino groups (−− NH2) with keto groups (== O). When nitrous acid reacts with the bases in DNA, it can change cytosine to uracil...

Q: One way that bacterial cells regulate DNA replication is through GATC methylation

One way that bacterial cells regulate DNA replication is through GATC methylation sites within the origin of replication. Would this mechanism work if the DNA was conservatively (rather than semiconse...

Q: The chromosome of E. coli contains 4.6 million bp

The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during...

Q: Here are two strands of DNA. —————————————— DNA polymerase→

Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the dir...

Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC

A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this...

Q: List and briefly describe the three types of functionally important sequences within

List and briefly describe the three types of functionally important sequences within bacterial origins of replication.

Q: Why does independent assortment promote genetic variation?

Why does independent assortment promote genetic variation?

Q: Explain the central dogma of genetics at the molecular level

Explain the central dogma of genetics at the molecular level

Q: At the molecular level, describe how σ factor recognizes a bacterial

At the molecular level, describe how σ factor recognizes a bacterial promoter. Be specific about the structure of σ factor and the type of chemical bonding.

Q: Let’s suppose a DNA mutation changes the consensus sequence at the −

Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit...

Q: What is the complementarity rule that governs the synthesis of an RNA

What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the seq...

Q: Describe the movement of the open complex along the DNA.

Describe the movement of the open complex along the DNA.

Q: Describe what happens to the chemical bonding interactions when transcriptional termination occurs

Describe what happens to the chemical bonding interactions when transcriptional termination occurs. Be specific about the type of chemical bonding.

Q: Discuss the differences between ρ-dependent and ρ-independent termination

Discuss the differences between ρ-dependent and ρ-independent termination.

Q: In Chapter 11, we discussed the function of DNA helicase,

In Chapter 11, we discussed the function of DNA helicase, which is involved in DNA replication. Discuss how the functions of ρ-protein and DNA helicase are similar and how they are different.

Q: Discuss the similarities and differences between RNA polymerase (described in this

Discuss the similarities and differences between RNA polymerase (described in this chapter) and DNA polymerase (described in Chapter 11).

Q: Mutations that occur at the end of a gene may alter the

Mutations that occur at the end of a gene may alter the sequence of the gene and prevent transcriptional termination. A. What types of mutations would prevent ρ-independent termination? B. What type...

Q: If a parent plant is Ttyy, how many different types of

If a parent plant is Ttyy, how many different types of gametes can it make?

Q: If the following RNA polymerases were missing from a eukaryotic cell,

If the following RNA polymerases were missing from a eukaryotic cell, what types of genes would not be transcribed? A. RNA polymerase I B. RNA polymerase II C. RNA polymerase III

Q: In bacteria, what event marks the end of the initiation stage

In bacteria, what event marks the end of the initiation stage of transcription?

Q: What sequence elements are found within the core promoter of protein-

What sequence elements are found within the core promoter of protein-encoding genes in eukaryotes? Describe their locations and specific functions.

Q: For each of the following transcription factors, explain how eukaryotic transcriptional

For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing. A. TFIIB B. TFIID C. TFIIH

Q: Describe the allosteric and torpedo models for transcriptional termination of RNA polymerase

Describe the allosteric and torpedo models for transcriptional termination of RNA polymerase II. Which model is more similar to ρ-dependent termination in bacteria and which model is more similar to ρ...

Q: Which eukaryotic transcription factor(s) shown in Figure 12.

Which eukaryotic transcription factor(s) shown in Figure 12.14 play(s) a role that is equivalent to that of σ factor in bacterial cells? From Figure 12.14:

Q: The initiation phase of eukaryotic transcription via RNA polymerase II is considered

The initiation phase of eukaryotic transcription via RNA polymerase II is considered an assembly and disassembly process. Which types of biochemical interactions—hydrogen bonding, ionic bonding, coval...

Q: A eukaryotic protein-encoding gene contains two introns and three exons

A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a...

Q: Describe the processing events that occur during the production of tRNA in

Describe the processing events that occur during the production of tRNA in E. coli.

Q: Describe the structure and function of a spliceosome. Speculate why the

Describe the structure and function of a spliceosome. Speculate why the spliceosome subunits contain snRNA. In other words, what do you think is/are the functional role(s) of snRNA during splicing?

Q: What are the two different meanings of horizontal lines in a pedigree

What are the two different meanings of horizontal lines in a pedigree?

Q: What is the unique feature of ribozyme function? Give two examples

What is the unique feature of ribozyme function? Give two examples described in this chapter.

Q: What does it mean to say that gene expression is colinear?

What does it mean to say that gene expression is colinear?

Q: What is the meaning of the term consensus sequence? Give an

What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?

Q: What is meant by the term self-splicing? What types

What is meant by the term self-splicing? What types of introns are self-splicing?

Q: In eukaryotes, what types of modifications occur to pre-mRNAs

In eukaryotes, what types of modifications occur to pre-mRNAs?

Q: What is alternative splicing? What is its biological significance?

What is alternative splicing? What is its biological significance?

Q: What is the function of a splicing factor? Explain how splicing

What is the function of a splicing factor? Explain how splicing factors can regulate the cell-specific splicing of mRNAs.

Q: Figure 12.21 shows the products of alternative splicing for the

Figure 12.21 shows the products of alternative splicing for the α-tropomyosin pre-mRNA. Let’s suppose that smooth muscle cells produce splicing factors that are not pro...

Q: The processing of ribosomal RNA in eukaryotes is shown in Figure 12

The processing of ribosomal RNA in eukaryotes is shown in Figure 12.16. Why is this called cleavage or processing but not splicing? From Figure 12.16:

Q: In the splicing of group I introns shown in Figure 12.

In the splicing of group I introns shown in Figure 12.18a, does the 5′ end of the intron have a phosphate group? Explain. From Figure 12.18a:

Q: Do these examples constitute variation in chromosome structure or variation in chromosome

Do these examples constitute variation in chromosome structure or variation in chromosome number? From Figure 1.9: a. A person with Down syndrome. She has 47 chromosomes rather than the common numbe...

Q: According to the mechanism shown in Figure 12.20, several

According to the mechanism shown in Figure 12.20, several snRNPs play different roles in the splicing of pre-mRNA. Identify the snRNP that recognizes each of the following sites: A. 5â€&su...

Q: What is the consensus sequence of the following six DNA sequences?

What is the consensus sequence of the following six DNA sequences? GGCATTGACT GCCATTGTCA CGCATAGTCA GGAAATGGGA GGCTTTGTCA GGCATAGTCA

Q: Mutations in bacterial promoters may increase or decrease the rate of gene

Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decre...

Q: According to the examples shown in Figure 12.5, which

According to the examples shown in Figure 12.5, which positions of the −35 sequence (i.e., first, second, third, fourth, fifth, or sixth) are more tolerant of changes? Do you think t...

Q: In Chapter 9, we considered the dimensions of the double helix

In Chapter 9, we considered the dimensions of the double helix. In an α helix of a protein, there are 3.6 amino acids per complete turn. Each amino acid advances the α heli...

Q: A mutation within a gene sequence changes the start codon to a

A mutation within a gene sequence changes the start codon to a stop codon. How will this mutation affect the transcription of this gene?

Q: What is the subunit composition of bacterial RNA polymerase holoenzyme? What

What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional roles of the different subunits?

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–

An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.

Q: What does it mean when we say that the genetic code is

What does it mean when we say that the genetic code is degenerate? Discuss the universality of the genetic code

Q: According to the adaptor hypothesis, is each of the following statements

According to the adaptor hypothesis, is each of the following statements true or false? A. The sequence of anticodons in tRNA directly recognizes codon sequences in mRNA, with some room for wobble....

Q: Eukaryotic cells exhibit compartmentalization. Define compartmentalization. From Figure

Eukaryotic cells exhibit compartmentalization. Define compartmentalization. From Figure 3.1:

Q: In bacteria, researchers have isolated strains that carry mutations within tRNA

In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with...

Q: The covalent attachment of an amino acid to a tRNA is an

The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it requires an input of energy for the reaction to proceed. Where does the energy come from to attach amin...

Q: The wobble rules for tRNA-mRNA pairing are shown in Figure

The wobble rules for tRNA-mRNA pairing are shown in Figure 13.12. If we assume that the tRNAs do not contain modified bases, what is the minimum number of tRNAs needed to recognize the codons for the...

Q: How many different sequences of mRNA could encode a peptide with the

How many different sequences of mRNA could encode a peptide with the sequence proline-glycine-methionine-serine?

Q: If a tRNA molecule carries a glutamic acid, what are the

If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it could contain? Be specific about the 5′ and 3′ ends.

Q: A tRNA has an anticodon sequence 3′–GGU–5′.

A tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?

Q: If a tRNA has an anticodon sequence 3′–CCI–5

If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

Q: Describe the anticodon of a single tRNA that could recognize the codons

Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′. What type(s) of base modification to this tRNA would allow it to also recognize 5′–AAA–3′?

Q: Describe the structural features that all tRNA molecules have in common.

Describe the structural features that all tRNA molecules have in common.

Q: In the tertiary structure of tRNA, where is the anticodon region

In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for the amino acid? Are these located adjacent to each other?

Q: What is the end result of crossing over?

What is the end result of crossing over?

Q: What is the role of aminoacyl-tRNA synthetase? The ability

What is the role of aminoacyl-tRNA synthetase? The ability of aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” Why has the function of this type of en...

Q: What is an activated amino acid?

What is an activated amino acid?

Q: Discuss the significance of modified bases within tRNA molecules.

Discuss the significance of modified bases within tRNA molecules.

Q: How and when does formylmethionine become attached to the initiator tRNA in

How and when does formylmethionine become attached to the initiator tRNA in bacteria?

Q: Is it necessary for a cell to make 61 different tRNA molecules

Is it necessary for a cell to make 61 different tRNA molecules, corresponding to the 61 codons for amino acids? Explain your answer.

Q: List the components required for translation. Describe the relative sizes of

List the components required for translation. Describe the relative sizes of these different components. In other words, which components are small molecules, macromolecules, or assemblies of macromol...

Q: Describe the components of eukaryotic ribosomal subunits and the location where the

Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the subunits occurs within living cells.

Q: The term subunit can be used in a variety of ways.

The term subunit can be used in a variety of ways. What is the difference between a protein subunit and a ribosomal subunit?

Q: Do the following events during bacterial translation occur primarily within the 30S

Do the following events during bacterial translation occur primarily within the 30S subunit, within the 50S subunit, or at the interface between these two ribosomal subunits? A. mRNA-tRNA recognition...

Q: What are the three stages of translation? Discuss the main events

What are the three stages of translation? Discuss the main events that occur during these three stages.

Q: Which two amino acids do you think are the least soluble in

Which two amino acids do you think are the least soluble in water?

Q: How do the four cells at the end of meiosis differ from

How do the four cells at the end of meiosis differ from the original mother cell?

Q: Describe the sequence in bacterial mRNA that promotes recognition by the 30S

Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.

Q: For each of the following initiation factors, how would eukaryotic initiation

For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF2 B. eIF4 C. eIF5

Q: How does a eukaryotic ribosome select its start codon? Describe the

How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA that provide an optimal context for a start codon.

Q: For each of the following sequences, rank them in order (

For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GC...

Q: Explain the functional roles of the A, P, and E

Explain the functional roles of the A, P, and E sites during translation.

Q: An mRNA has the following sequence: 5′–AUG UAC

An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence of the polypeptide that would be encoded by this mRNA. Be specific about the amino-terminus and carb...

Q: Which steps during the translation of bacterial mRNA involve an interaction between

Which steps during the translation of bacterial mRNA involve an interaction between complementary strands of RNA?

Q: What is the function of the nucleolus?

What is the function of the nucleolus?

Q: In which of the ribosomal sites, the A site, P

In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A. A tRNA without an amino acid attached B. A tRNA with a polypeptide attached C. A tRNA with a sin...

Q: What is a polysome?

What is a polysome?

Q: How is this attachment of chromosomes to kinetochore microtubules different from their

How is this attachment of chromosomes to kinetochore microtubules different from their attachment during metaphase of mitosis?

Q: Referring to Figure 13.17, explain why the ribosome translocates

Referring to Figure 13.17, explain why the ribosome translocates along the mRNA in the 5′ to 3′ direction rather than the 3′ to 5â€&sup...

Q: Lactose permease, a protein of E. coli, is composed

Lactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus t...

Q: An mRNA encodes a polypeptide that is 312 amino acids in length

An mRNA encodes a polypeptide that is 312 amino acids in length. The 53rd codon in this polypeptide is a tryptophan codon. A mutation in the gene that encodes this polypeptide changes this tryptophan...

Q: Explain what is meant by the coupling of transcription and translation in

Explain what is meant by the coupling of transcription and translation in bacteria. Does coupling occur in bacterial and/or eukaryotic cells? Explain.

Q: After the intron (which is in a lariat configuration) is

After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in...

Q: What is an allodiploid? What factor determines the fertility of an

What is an allodiploid? What factor determines the fertility of an allodiploid? Why are allotetraploids more likely than allodiploids to be fertile?

Q: Meiotic nondisjunction usually occurs during meiosis I. What is not separating

Meiotic nondisjunction usually occurs during meiosis I. What is not separating properly: bivalents or sister chromatids? What is not separating properly during mitotic nondisjunction?

Q: Table 8.1 shows that Turner syndrome occurs when an individual

Table 8.1 shows that Turner syndrome occurs when an individual inherits one X chromosome but lacks a second sex chromosome. Can Turner syndrome be due to nondisjunction during oogenesis, spermatogenes...

Q: Male honeybees, which are haploid, produce sperm by meiosis.

Male honeybees, which are haploid, produce sperm by meiosis. Explain what unusual event (compared with other animals) must occur during spermatogenesis in honeybees to produce sperm. Does this unusual...

Q: Briefly explain how gene expression occurs at the molecular level.

Briefly explain how gene expression occurs at the molecular level.

Q: What are polar bodies?

What are polar bodies?

Q: A human gene called the β-globin gene encodes a polypeptide

A human gene called the β-globin gene encodes a polypeptide that functions as a subunit of the protein known as hemoglobin. Hemoglobin is found within red blood cells; it carries oxygen. In human popu...

Q: What is meant by the term genetic variation? Give two examples

What is meant by the term genetic variation? Give two examples of genetic variation not discussed in Chapter 1. What causes genetic variation at the molecular level?

Q: What is the cause of Down syndrome?

What is the cause of Down syndrome?

Q: Your textbook describes how the detrimental symptoms associated with the disease phenylketonuria

Your textbook describes how the detrimental symptoms associated with the disease phenylketonuria (PKU) are caused by a faulty gene. Even so, a change in diet can prevent these symptoms. Pick a trait i...

Q: What is meant by the term diploid? Which cells of the

What is meant by the term diploid? Which cells of the human body are diploid, and which cells are not?

Q: Why did Mendel’s work refute the idea of blending inheritance?

Why did Mendel’s work refute the idea of blending inheritance?

Q: A cross is made between a pea plant that has constricted pods

A cross is made between a pea plant that has constricted pods (a recessive trait; smooth is dominant) and is heterozygous for seed color (yellow is dominant to green) and a plant that is heterozygous...

Q: A pea plant that is heterozygous with regard to seed color (

A pea plant that is heterozygous with regard to seed color (yellow is dominant to green) is allowed to self-fertilize. What are the predicted outcomes of genotypes and phenotypes of the offspring?

Q: Describe the significance of nonparentals with regard to the law of independent

Describe the significance of nonparentals with regard to the law of independent assortment. In other words, explain how the appearance of nonparentals refutes a linkage hypothesis.

Q: For the following pedigrees, describe what you think is the most

For the following pedigrees, describe what you think is the most likely inheritance pattern (dominant versus recessive). Explain your reasoning. Filled (black) symbols indicate affected individuals....

Q: Are all of the cell nuclei in the embryo sac haploid or

Are all of the cell nuclei in the embryo sac haploid or is just the egg haploid?

Q: Ectrodactyly, also known as “lobster claw syndrome,” is a

Ectrodactyly, also known as “lobster claw syndrome,” is a recessive disorder in humans. If a phenotypically unaffected couple produces an affected offspring, what are the following probabilities? A....

Q: Identical twins are produced from the same sperm and egg (which

Identical twins are produced from the same sperm and egg (which splits after the first mitotic division), whereas fraternal twins are produced from separate sperm and separate egg cells. If two parent...

Q: In cocker spaniels, solid coat color is dominant over spotted coat

In cocker spaniels, solid coat color is dominant over spotted coat color. If two heterozygous dogs were crossed to each other, what would be the probability of the following combinations of offspring?...

Q: A cross was made between a white male dog and two different

A cross was made between a white male dog and two different black females. The first female gave birth to eight black pups, and the second female gave birth to four white and three black pups. What ar...

Q: In humans, the allele for brown eye color (B)

In humans, the allele for brown eye color (B) is dominant to that for blue eye color (b). If two heterozygous parents produce children, what are the following probabilities? A. The first two children...

Q: Albinism, a condition characterized by a partial or total lack of

Albinism, a condition characterized by a partial or total lack of skin pigment, is a recessive human trait. If a phenotypically unaffected couple produce an albino child, what is the probability that...

Q: What is the difference between cross-fertilization and self-fertilization

What is the difference between cross-fertilization and self-fertilization?

Q: A true-breeding tall plant was crossed to a dwarf plant

A true-breeding tall plant was crossed to a dwarf plant. Tallness is a dominant trait. The F1 individuals were allowed to self-fertilize. What are the following probabilities for the F2 generation? A...

Q: For pea plants with the following genotypes, list the possible gametes

For pea plants with the following genotypes, list the possible gametes that the plant can make: A. TT Yy Rr C. Tt Yy Rr B. Tt YY rr D. tt Yy rr

Q: An individual has the genotype Aa Bb Cc and makes an abnormal

An individual has the genotype Aa Bb Cc and makes an abnormal gamete with the genotype AaBc. Does this gamete violate the law of independent assortment or the law of segregation (or both)? Explain you...

Q: At which stage do homologous chromosomes separate from each other?

At which stage do homologous chromosomes separate from each other?

Q: In people with maple syrup urine disease, the body is unable

In people with maple syrup urine disease, the body is unable to metabolize the amino acids leucine, isoleucine, and valine. One of the symptoms is that the urine smells like maple syrup. An unaffected...

Q: Marfan syndrome is a rare inherited human disorder characterized by unusually long

Marfan syndrome is a rare inherited human disorder characterized by unusually long limbs and digits plus defects in the heart (especially the aorta) and the eyes, among other symptoms. Following is a...

Q: A true-breeding pea plant with round and green seeds was

A true-breeding pea plant with round and green seeds was crossed to a true-breeding plant with wrinkled and yellow seeds. Round and yellow seeds are the dominant traits. The F1 plants were allowed to...

Q: A true-breeding tall pea plant was crossed to a true

A true-breeding tall pea plant was crossed to a true-breeding dwarf plant. What is the probability that an F1 individual will be truebreeding? What is the probability that an F1 individual will be a t...

Q: What are the expected phenotypic ratios from the following cross: Tt

What are the expected phenotypic ratios from the following cross: Tt Rr yy Aa × Tt rr YY Aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal; T, R, Y...

Q: On rare occasions, an organism may have three copies of a

On rare occasions, an organism may have three copies of a chromosome and therefore has three copies of the genes on that chromosome (instead of the usual number of two copies). For such a rare organis...

Q: Honeybees are unusual in that male bees (drones) have only

Honeybees are unusual in that male bees (drones) have only one copy of each gene, but female bees have two copies of their genes. This difference arises because drones develop from eggs that have not...

Q: Describe the difference between genotype and phenotype. Give three examples.

Describe the difference between genotype and phenotype. Give three examples. Is it possible for two individuals to have the same phenotype but different genotypes?

Q: A pea plant that is dwarf with green, wrinkled seeds was

A pea plant that is dwarf with green, wrinkled seeds was crossed to a true-breeding plant that is tall with yellow, round seeds. The F1 generation was allowed to self-fertilize. What types of gametes,...

Q: A true-breeding plant with round and green seeds was crossed

A true-breeding plant with round and green seeds was crossed to a true-breeding plant with wrinkled and yellow seeds. The F1 plants were allowed to self-fertilize. What is the probability of obtaining...

Q: Let’s suppose a pea plant is heterozygous for three genes, Tt

Let’s suppose a pea plant is heterozygous for three genes, Tt Yy Rr, and each gene is on a different chromosome. How many different ways could the three pairs of homologous chromosomes line up during...

Q: With regard to genotypes, what is a true-breeding organism

With regard to genotypes, what is a true-breeding organism?

Q: How can you determine whether an organism is heterozygous or homozygous for

How can you determine whether an organism is heterozygous or homozygous for a dominant trait?

Q: In your own words, describe Mendel’s law of segregation. Do

In your own words, describe Mendel’s law of segregation. Do not use the word segregation in your answer.

Q: Based on genes in pea plants that we have considered in this

Based on genes in pea plants that we have considered in this chapter, which statement(s) is/are not correct? A. The gene causing tall plants is an allele of the gene causing dwarf plants. B. The gen...

Q: In a cross between a heterozygous tall pea plant and a dwarf

In a cross between a heterozygous tall pea plant and a dwarf plant, predict the ratios of the offspring’s genotypes and phenotypes.

Q: Do you know the genotype of an individual with a recessive trait

Do you know the genotype of an individual with a recessive trait and/or a dominant trait? Explain your answer.

Q: The process of binary fission begins with a single mother cell and

The process of binary fission begins with a single mother cell and ends with two daughter cells. Would you expect the mother and daughter cells to be genetically identical? Explain why or why not.

Q: The arrangement of homologs during metaphase of meiosis I is a random

The arrangement of homologs during metaphase of meiosis I is a random process. In your own words, explain what this means.

Q: A eukaryotic cell is diploid and contains 10 chromosomes (5 in

A eukaryotic cell is diploid and contains 10 chromosomes (5 in each set). In mitosis and meiosis, how many daughter cells will be produced, and how many chromosomes will each one contain?

Q: If a diploid cell contains six chromosomes (i.e.,

If a diploid cell contains six chromosomes (i.e., three per set), how many possible random arrangements of homologs could occur during metaphase of meiosis I?

Q: What is the difference between the X-Y and X-

What is the difference between the X-Y and X-0 systems of sex determination?

Q: A cell has four pairs of chromosomes. Assuming that crossing over

A cell has four pairs of chromosomes. Assuming that crossing over does not occur, what is the probability that a gamete will contain all of the paternal chromosomes? If n equals the number of chromoso...

Q: With regard to question C13, how would the phenomenon of crossing

With regard to question C13, how would the phenomenon of crossing over affect the results? In other words, would the probability of a gamete inheriting only paternal chromosomes be higher or lower? Ex...

Q: Eukaryotic cells must sort their chromosomes during mitosis so that each daughter

Eukaryotic cells must sort their chromosomes during mitosis so that each daughter cell receives the correct number of chromosomes. Why don’t bacteria need to sort their chromosomes?

Q: Why is it necessary for the chromosomes to condense during mitosis and

Why is it necessary for the chromosomes to condense during mitosis and meiosis? What do you think might happen if the chromosomes were not condensed?

Q: Nine-banded armadillos almost always give birth to four offspring that

Nine-banded armadillos almost always give birth to four offspring that are genetically identical quadruplets. Explain how you think this happens.

Q: A diploid species has four chromosomes per set for a total of

A diploid species has four chromosomes per set for a total of eight chromosomes in its somatic cells. Draw such a cell as it would look in late prophase of meiosis II and prophase of mitosis. Discuss...

Q: Explain why the products of meiosis may not be genetically identical,

Explain why the products of meiosis may not be genetically identical, whereas the products of mitosis are.

Q: What is a homolog? With regard to genes and alleles,

What is a homolog? With regard to genes and alleles, how are homologs similar to and different from each other?

Q: The period between meiosis I and meiosis II is called interphase II

The period between meiosis I and meiosis II is called interphase II. Does DNA replication take place during interphase II?

Q: List several ways in which telophase appears to be the reverse of

List several ways in which telophase appears to be the reverse of prophase and prometaphase.

Q: Where is the information to make a polypeptide stored?

Where is the information to make a polypeptide stored?

Q: Corn has 10 chromosomes per set, and the sporophyte of the

Corn has 10 chromosomes per set, and the sporophyte of the species is diploid. If you performed a karyotype, what is the total number of chromosomes you would expect to see in each of the following ty...

Q: The arctic fox has 50 chromosomes (25 per set), and

The arctic fox has 50 chromosomes (25 per set), and the common red fox has 38 chromosomes (19 per set). These species can interbreed to produce viable but infertile offspring. How many chromosomes wou...

Q: Let’s suppose that a gene affecting pigmentation is found on the X

Let’s suppose that a gene affecting pigmentation is found on the X chromosome (in mammals or insects) or the Z chromosome (in birds) but not on the Y or W chromosome. It is found on...

Q: Describe the cellular differences between male and female gametes.

Describe the cellular differences between male and female gametes.

Q: At puberty, the testes contain a finite number of cells and

At puberty, the testes contain a finite number of cells and produce an enormous number of sperm cells during the life span of a male. Explain why testes do not run out of spermatogonial cells.

Q: Describe the timing of meiosis I and II during human oogenesis.

Describe the timing of meiosis I and II during human oogenesis.

Q: Three genes (A, B, and C) are found

Three genes (A, B, and C) are found on three different chromosomes. For the following diploid genotypes, describe all of the possible gamete combinations. A. Aa Bb Cc B. AA Bb CC C. Aa BB Cc D. Aa...

Q: What is a sister chromatid? Are sister chromatids genetically similar or

What is a sister chromatid? Are sister chromatids genetically similar or identical? Explain.

Q: With regard to sister chromatids, which phase of mitosis is the

With regard to sister chromatids, which phase of mitosis is the organization phase, and which is the separation phase?

Q: A species is diploid and has three chromosomes per set. Make

A species is diploid and has three chromosomes per set. Make a drawing showing what the chromosomes would look like in the G1 and G2 phases of the cell cycle.

Q: How do you think the end results would be affected if the

How do you think the end results would be affected if the cells were not treated with a hypotonic solution?

Q: How does the attachment of kinetochore microtubules to the kinetochore differ in

How does the attachment of kinetochore microtubules to the kinetochore differ in metaphase of meiosis I compared to metaphase of mitosis? Discuss what you think would happen if a sister chromatid was...

Q: For the following events, specify whether they occur during mitosis,

For the following events, specify whether they occur during mitosis, meiosis I, or meiosis II: A. Separation of conjoined chromatids within a pair of sister chromatids B. Pairing of homologous chrom...

Q: Identify the key events during meiosis that result in a 50%

Identify the key events during meiosis that result in a 50% reduction in the amount of genetic material per cell.

Q: A cell is diploid and contains three chromosomes per set. Draw

A cell is diploid and contains three chromosomes per set. Draw the arrangement of the chromosomes during metaphase of mitosis and metaphase of meiosis I and II. In your drawing, make one set dark and...

Q: Describe the differences among dominance, incomplete dominance, codominance, and

Describe the differences among dominance, incomplete dominance, codominance, and overdominance.

Q: A woman with type B blood has a child with type O

A woman with type B blood has a child with type O blood. What are the possible genotypes and blood types of the father?

Q: A type A woman is the daughter of a type O father

A type A woman is the daughter of a type O father and a type A mother. If she has children with a type AB man, what are the following probabilities? A. A type AB child B. A type O child C. The firs...

Q: In Shorthorn cattle, coat color is controlled by a single gene

In Shorthorn cattle, coat color is controlled by a single gene that can exist as a red allele (R) or a white allele (r). The heterozygotes (Rr) have a color called roan that looks less red than the RR...

Q: In chickens, the Leghorn variety has white feathers due to an

In chickens, the Leghorn variety has white feathers due to an autosomal dominant allele. Silkies have white feathers due to a recessive allele in a second (different) gene. If a true-breeding white Le...

Q: Propose the most likely mode of inheritance (autosomal dominant, autosomal

Propose the most likely mode of inheritance (autosomal dominant, autosomal recessive, or X-linked recessive) for the following pedigrees. Affected individuals are shown with filled (black) symbols....

Q: How are homologs similar to each other and how are they different

How are homologs similar to each other and how are they different?

Q: A human disease known as vitamin D–resistant rickets is inherited

A human disease known as vitamin D–resistant rickets is inherited as an X-linked dominant trait. If a male with the disease produces children with a female who does not have the disease, what is the e...

Q: Hemophilia is an X-linked recessive trait in humans. If

Hemophilia is an X-linked recessive trait in humans. If a heterozygous woman has children with an unaffected man, what is the probability of each of the following combinations of children? A. An affe...

Q: Incontinentia pigmenti, a rare, X-linked dominant disorder in

Incontinentia pigmenti, a rare, X-linked dominant disorder in humans, is characterized by swirls of pigment in the skin. If an affected female, who had an unaffected father, has children with an unaff...

Q: Scurs in cattle is a sex-influenced trait. A cow

Scurs in cattle is a sex-influenced trait. A cow with no scurs whose mother had scurs had offspring with a bull with scurs whose father had no scurs. What are the probabilities of each of the followin...

Q: In rabbits, the color of body fat is controlled by a

In rabbits, the color of body fat is controlled by a single gene with two alleles, designated Y and y. The outcome of this trait is affected by the diet of the rabbit. When raised on a standard vegeta...

Q: Discuss the differences among sex-influenced, sex-limited,

Discuss the differences among sex-influenced, sex-limited, and sex-linked inheritance. Give examples.

Q: In cats, a temperature-sensitive allele produces the Siamese phenotype

In cats, a temperature-sensitive allele produces the Siamese phenotype, in which the cooler extremities are dark and the warmer trunk area is lighter. A Siamese cat that spends most of its time outsid...

Q: The trait of feathering in fowls is a sex-limited trait

The trait of feathering in fowls is a sex-limited trait controlled by a single gene. Females always exhibit hen-feathering, as do HH and Hh males. Only hh males show cock-feathering. Starting with two...

Q: Based on the pedigree shown here for a trait determined by a

Based on the pedigree shown here for a trait determined by a single gene (affected individuals are shown in black), state whether it would be possible for the trait to be inherited in each of the foll...

Q: The pedigree shown here involves a trait determined by a single gene

The pedigree shown here involves a trait determined by a single gene (affected individuals are shown in black). Which of the following patterns of inheritance are possible for this trait? A. Recessiv...

Q: What type of bonding is responsible for the formation of the two

What type of bonding is responsible for the formation of the two types of secondary structures?

Q: What is the function of the FtsZ protein during binary fission?

What is the function of the FtsZ protein during binary fission?

Q: Let’s suppose you have pedigree data from thousands of different families involving

Let’s suppose you have pedigree data from thousands of different families involving a particular genetic disease. How would you decide whether the disease is inherited as a recessive trait as opposed...

Q: Compare phenotypes at the molecular, cellular, and organism levels for

Compare phenotypes at the molecular, cellular, and organism levels for individuals who are homozygous for the hemoglobin allele, HbA HbA, and the sickle cell allele, HbS HbS.

Q: In humans, a very rare dominant allele that causes the little

In humans, a very rare dominant allele that causes the little finger to be crooked has a penetrance of 80%. In other words, 80% of heterozygotes carrying the allele will have a crooked little finger....

Q: A sex-influenced trait in humans affects the length of the

A sex-influenced trait in humans affects the length of the index finger. A short allele is dominant in males and recessive in females. Heterozygous males have an index finger that is significantly sho...

Q: Three coat-color patterns that occur in some breeds of horses

Three coat-color patterns that occur in some breeds of horses are termed cremello (beige), chestnut (brown), and palomino (golden with light mane and tail). If two palomino horses are mated, they prod...

Q: A woman with an abnormally long chromosome 13 (and a normal

A woman with an abnormally long chromosome 13 (and a normal homolog of chromosome 13) has children with a man with an abnormally short chromosome 11 (and a normal homolog of chromosome 11). What is th...

Q: What is meant by a gene interaction? How can a gene

What is meant by a gene interaction? How can a gene interaction be explained at the molecular level?

Q: Assuming that such a fly would be viable, what would be

Assuming that such a fly would be viable, what would be the sex of a fruit fly with the following chromosomal composition? A. One X chromosome and two sets of autosomes B. Two X chromosomes, one Y c...

Q: What would be the sex of a human with each of the

What would be the sex of a human with each of the following sets of sex chromosomes? A. XXX B. X (also described as X0) C. XYY D. XXY

Q: Wooly hair is a rare dominant trait found in people of Scandinavian

Wooly hair is a rare dominant trait found in people of Scandinavian descent in which the hair resembles the wool of a sheep. A male with wooly hair, who has a mother with straight hair, moves to an is...

Q: What is the difference between the G0 and G1 phases?

What is the difference between the G0 and G1 phases?

Q: Huntington disease is a rare dominant trait that causes neurodegeneration later in

Huntington disease is a rare dominant trait that causes neurodegeneration later in life. A man in his thirties, who already has three children, discovers that his mother has Huntington disease though...

Q: Let’s suppose a recessive allele encodes a completely defective protein. If

Let’s suppose a recessive allele encodes a completely defective protein. If the functional allele is dominant, what does that tell you about the amount of the functional protein that is sufficient to...

Q: A nectarine is a peach without the fuzz. The difference is

A nectarine is a peach without the fuzz. The difference is controlled by a single gene that is found in two alleles, D and d. At the molecular level, do you think that the nectarine is homozygous for...

Q: An allele in Drosophila produces a star-eye trait in the

An allele in Drosophila produces a star-eye trait in the heterozygous individual. However, the star-eye allele is lethal in homozygotes. What would be the ratio of phenotypes of surviving offspring if...

Q: A seed dealer wants to sell four-o’clock seeds that will

A seed dealer wants to sell four-o’clock seeds that will produce only a single color of flowers (red, white, or pink). Explain how this should be done.

Q: The blood serum from one individual (let’s call this person individual

The blood serum from one individual (let’s call this person individual 1) is known to agglutinate the red blood cells from a second individual (individual 2). List the pairwise combinations of possibl...

Q: Which blood type phenotypes (A, B, AB, and

Which blood type phenotypes (A, B, AB, and/or O) provide an unambiguous genotype? Is it possible for a couple to produce a family of children in which all four blood types are represented? If so, what...

Q: Define the term epigenetic inheritance, and describe two examples.

Define the term epigenetic inheritance, and describe two examples.

Q: With regard to the numbers of sex chromosomes, explain why dosage

With regard to the numbers of sex chromosomes, explain why dosage compensation is necessary.

Q: What is a Barr body? How is its structure different from

What is a Barr body? How is its structure different from that of other chromosomes in the cell? How does the structure of a Barr body affect the level of X-linked gene expression?

Q: What is the difference between homologs and sister chromatids?

What is the difference between homologs and sister chromatids?

Q: Among different species, describe three distinct mechanisms for accomplishing dosage compensation

Among different species, describe three distinct mechanisms for accomplishing dosage compensation.

Q: Describe when X-chromosome inactivation occurs and how this leads to

Describe when X-chromosome inactivation occurs and how this leads to phenotypic results at the organism level. In your answer, you should explain why XCI causes results such as variegated coat pattern...

Q: Describe the molecular process of X-chromosome inactivation. This description

Describe the molecular process of X-chromosome inactivation. This description should include the three phases of inactivation and the role of the Xic. Explain what happens to the X chromosomes during...

Q: On rare occasions, a human male is born who is somewhat

On rare occasions, a human male is born who is somewhat feminized compared with other males. Microscopic examination of the cells of one such individual revealed that he has a single Barr body in each...

Q: How many Barr bodies would you expect to find in humans with

How many Barr bodies would you expect to find in humans with the following abnormal compositions of sex chromosomes? A. XXY B. XYY C. XXX D. X0 (a person with just a single X chromosome)

Q: Describe the inheritance pattern of maternal effect genes. Explain how the

Describe the inheritance pattern of maternal effect genes. Explain how the maternal effect occurs at the cellular level. What are the expected functional roles of the proteins that are encoded by mate...

Q: A maternal effect gene exists in a dominant N (functional)

A maternal effect gene exists in a dominant N (functional) allele and a recessive n (nonfunctional) allele. What would be the ratios of genotypes and phenotypes for the offspring of the following cros...

Q: A Drosophila embryo dies during early embryogenesis due to a recessive maternal

A Drosophila embryo dies during early embryogenesis due to a recessive maternal effect allele called bicoid−. The wild-type allele is designated bicoid+. What are the genotypes and phenotypes of the e...

Q: For Mendelian inheritance, the nuclear genotype (i.e.,

For Mendelian inheritance, the nuclear genotype (i.e., the alleles found on chromosomes in the cell nucleus) directly influences an offspring’s traits. In contrast, for non-Mendelian inheritance patte...

Q: Suppose a maternal effect gene exists as a functional dominant allele and

Suppose a maternal effect gene exists as a functional dominant allele and a nonfunctional recessive allele. A mother who is phenotypically abnormal produces all normal offspring. Explain the genotype...

Q: Where are the two ends of a kinetochore microtubule?

Where are the two ends of a kinetochore microtubule?

Q: Suppose that a gene affects the anterior morphology in house flies and

Suppose that a gene affects the anterior morphology in house flies and is inherited as a maternal effect gene. The gene exists in a functional allele, H, and a recessive nonfunctional allele, h, which...

Q: Explain why maternal effect genes exert their effects during the early stages

Explain why maternal effect genes exert their effects during the early stages of development.

Q: As described in Chapter 22, researchers have been able to clone

As described in Chapter 22, researchers have been able to clone mammals by fusing a cell having a diploid nucleus (i.e., a somatic cell) with an egg that has had its nucleus removed. A. With regard t...

Q: What is the difference in meaning between the terms genetic recombination and

What is the difference in meaning between the terms genetic recombination and crossing over?

Q: In humans, a rare dominant disorder known as nail-patella

In humans, a rare dominant disorder known as nail-patella syndrome causes abnormalities in the fingernails, toenails, and kneecaps. Researchers have examined family pedigrees with regard to this disor...

Q: When true-breeding mice with brown fur and short tails (

When true-breeding mice with brown fur and short tails (BBtt) were crossed to true-breeding mice with white fur and long tails (bbTT), all of the F1 offspring had brown fur and long tails. The F1 offs...

Q: Though we often think of genes in terms of the phenotypes they

Though we often think of genes in terms of the phenotypes they produce (e.g., curly leaves, flaky tail, brown eyes), the molecular function of most genes is to encode proteins. Many cellular proteins...

Q: If the likelihood of a single crossover in a particular chromosomal region

If the likelihood of a single crossover in a particular chromosomal region is 10%, what is the theoretical likelihood of a double or triple crossover in that same region? How would positive interferen...

Q: In most two-factor crosses involving linked genes, we cannot

In most two-factor crosses involving linked genes, we cannot tell if a double crossover between the two genes has occurred because the offspring will inherit the nonrecombinant pattern of alleles. How...

Q: Researchers have discovered that some regions of chromosomes are much more likely

Researchers have discovered that some regions of chromosomes are much more likely than others to cross over. We might call such a region a “hot spot” for crossing over. Let’s suppose that two genes, g...

Q: During which phase are sister chromatids separated and sent to opposite poles

During which phase are sister chromatids separated and sent to opposite poles?

Q: Describe the unique features of ascomycetes that lend themselves to genetic analysis

Describe the unique features of ascomycetes that lend themselves to genetic analysis.

Q: When a chi square analysis is applied to solve a linkage problem

When a chi square analysis is applied to solve a linkage problem, explain why an independent assortment hypothesis is proposed.

Q: In the experiment of Figure 13.7, what would be

In the experiment of Figure 13.7, what would be the predicted amounts of amino acids incorporated into polypeptides if the RNA was a random polymer containing 50% C and 50% G? From Figure 13.7:

Q: Polypeptides can be translated in vitro. Would a bacterial mRNA be

Polypeptides can be translated in vitro. Would a bacterial mRNA be translated in vitro by eukaryotic ribosomes? Would a eukaryotic mRNA be translated in vitro by bacterial ribosomes? Why or why not?

Q: Discuss how the elucidation of the structure of the ribosome can help

Discuss how the elucidation of the structure of the ribosome can help us to understand its function.

Q: Describe the structure of a polysome, which is depicted in Figure

Describe the structure of a polysome, which is depicted in Figure 13.13a. From Figure 13.13a:

Q: Chapter 21 describes a blotting method known as Western blotting that can

Chapter 21 describes a blotting method known as Western blotting that can be used to detect the production of a polypeptide that is translated from a particular mRNA. In this method, a protein is dete...

Q: The technique of Western blotting is described in Chapter 21 and also

The technique of Western blotting is described in Chapter 21 and also in experimental question E5. Let’s suppose a researcher is interested in the effects of mutations on the expression of a proteinen...

Q: The protein known as tyrosinase is needed to make certain types of

The protein known as tyrosinase is needed to make certain types of pigments. Tyrosinase is composed of a single polypeptide with 511 amino acids. The molecular mass of this protein is approximately 61...

Q: Although 61 codons specify the 20 amino acids, most species display

Although 61 codons specify the 20 amino acids, most species display a codon bias. This means that certain codons are used much more frequently than other codons. For example, UUA, UUG, CUU, CUC, CUA,...

Q: What causes the cleavage furrow in an animal cell to ingress?

What causes the cleavage furrow in an animal cell to ingress?

Q: In Chapter 23, the technique of fluorescence in situ hybridization (

In Chapter 23, the technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such a...

Q: In a P1 transduction experiment, the P1 lysate contains phages that

In a P1 transduction experiment, the P1 lysate contains phages that carry pieces of the host chromosomal DNA, but the lysate also contains broken pieces of chromosomal DNA (see Figure 7.10). If a P1 l...

Q: Can you devise an experimental strategy to get a P1 phage to

Can you devise an experimental strategy to get a P1 phage to transduce the entire genome of a λ (lambda) phage from one strain of bacterium to another strain? (Note: The general features of the reprod...

Q: Let’s suppose a new strain of P1 phage has been identified that

Let’s suppose a new strain of P1 phage has been identified that packages larger pieces of the E. coli chromosome. This P1 strain packages pieces of the E. coli chromosome that are 5 minutes long. If t...

Q: If two bacterial genes are 0.6 minute apart on the

If two bacterial genes are 0.6 minute apart on the bacterial chromosome, what cotransduction frequency would you expect to observe in a cotransduction experiment using P1 phage?

Q: In a cotransduction experiment involving P1, the cotransduction frequency was 0

In a cotransduction experiment involving P1, the cotransduction frequency was 0.53. How far apart are the two genes?

Q: In a cotransduction experiment using P1, the transfer of one gene

In a cotransduction experiment using P1, the transfer of one gene is selected for and the presence of the second gene is then determined. If 0 out of 1000 transductants that carry the first gene also...

Q: In a cotransformation experiment (see question 4 of More Genetic TIPS

In a cotransformation experiment (see question 4 of More Genetic TIPS), DNA was isolated from a donor strain that was proA+ and strC+ and sensitive to tetracycline. (The proA and strC genes confer the...

Q: In mice, a trait called snubnose is recessive to a wild

In mice, a trait called snubnose is recessive to a wild-type nose, a trait called pintail is dominant to a normal tail, and a trait called jerker (a defect in motor skills) is recessive to a normal ga...

Q: In Drosophila, an allele causing vestigial wings is 12.5

In Drosophila, an allele causing vestigial wings is 12.5 mu away from another allele that causes purple eyes. A third gene that affects body color has an allele that causes black body color. This thir...

Q: Why are both of these colors considered to be wild type?

Why are both of these colors considered to be wild type?

Q: Three autosomal genes are linked along the same chromosome. The distance

Three autosomal genes are linked along the same chromosome. The distance between gene A and B is 7 mu, the distance between B and C is 11 mu, and the distance between A and C is 4 mu. An individual th...

Q: Let’s suppose that two different X-linked genes exist in mice

Let’s suppose that two different X-linked genes exist in mice, designated with the letters N and L. Gene N exists in a dominant, normal allele and in a recessive allele, n, that is lethal. Similarly,...

Q: The alleles his-5 and lys-1, found in

The alleles his-5 and lys-1, found in baker’s yeast, result in cells that require histidine and lysine for growth, respectively. A cross was made between two haploid yeast strains that are his-5 lys-1...

Q: In fruit flies, curved wings are recessive to straight wings,

In fruit flies, curved wings are recessive to straight wings, and ebony body is recessive to gray body. A cross was made between true-breeding flies with curved wings and gray bodies and flies with st...

Q: A recessive allele in mice results in an unusally long neck.

A recessive allele in mice results in an unusally long neck. Sometimes, during early embryonic development, the long neck causes the embryo to die. An experimenter began with a population of true-bree...

Q: The data with Figure 2.5 show the results of the

The data with Figure 2.5 show the results of the F2 generation for seven of Mendel’s experiments. Conduct a chi square analysis to determine if these data are consistent with the law of segregation.

Q: Explain the technical differences between a cross-fertilization experiment versus a

Explain the technical differences between a cross-fertilization experiment versus a self-fertilization experiment.

Q: How long did it take Mendel to complete the experiment in Figure

How long did it take Mendel to complete the experiment in Figure 2.5? From Figure 2.5:

Q: For all seven characters described in the data of Figure 2.

For all seven characters described in the data of Figure 2.5, Mendel allowed the F2 plants to self-fertilize. He found that when F2 plants with recessive traits were crossed to each other, they always...

Q: From the point of view of crosses and data collection, what

From the point of view of crosses and data collection, what are the experimental differences between a single-factor and a two-factor cross?

Q: What features of this pedigree indicate that the allele for Duchenne muscular

What features of this pedigree indicate that the allele for Duchenne muscular dystrophy is X-linked? From Figure 4.10:

Q: As in many animals, albino coat color is a recessive trait

As in many animals, albino coat color is a recessive trait in guinea pigs. Researchers removed the ovaries from an albino female guinea pig and then transplanted ovaries from a true-breeding black gui...

Q: The fungus Melampsora lini causes a disease known as flax rust.

The fungus Melampsora lini causes a disease known as flax rust. Different strains of M. lini cause varying degrees of the rust disease. Conversely, different strains of flax are resistant or sensitive...

Q: For Mendel’s data for the experiment in Figure 2.8,

For Mendel’s data for the experiment in Figure 2.8, conduct a chi square analysis to determine if the data agree with Mendel’s law of independent assortment. From...

Q: Would it be possible to deduce the law of independent assortment from

Would it be possible to deduce the law of independent assortment from a single-factor cross? Explain your answer.

Q: When studying living cells in a laboratory, researchers sometimes use drugs

When studying living cells in a laboratory, researchers sometimes use drugs as a way to cause cells to remain in a particular phase of the cell cycle. For example, aphidicolin inhibits DNA synthesis i...

Q: Discuss why crosses (i.e., the experiments of Mendel

Discuss why crosses (i.e., the experiments of Mendel) and the microscopic observations of chromosomes during mitosis and meiosis were both needed to deduce the chromosome theory of inheritance.

Q: Female flies with white eyes and miniature wings (both X-

Female flies with white eyes and miniature wings (both X-linked recessive traits) were crossed to male flies with red eyes and long wings. On rare occasions, female offspring were produced with white...

Q: Experimentally, how do you think researchers were able to determine that

Experimentally, how do you think researchers were able to determine that the Y chromosome causes maleness in mammals, whereas the ratio of X chromosomes to the sets of autosomes causes sex determinati...

Q: Let’s suppose you conducted an experiment involving genetic crosses and calculated a

Let’s suppose you conducted an experiment involving genetic crosses and calculated a chi square value of 1.005. There were four categories of offspring (i.e., the degrees of freedom equaled 3). Explai...

Q: A tall pea plant with axial flowers was crossed to a dwarf

A tall pea plant with axial flowers was crossed to a dwarf plant with terminal flowers. Tallness and axial flowers are dominant traits. The following offspring were obtained: 27 tall, axial flowers; 2...

Q: Explain why the reciprocal cross yields a different result from the first

Explain why the reciprocal cross yields a different result from the first cross.

Q: In Morgan’s experiments, which result do you think is the most

In Morgan’s experiments, which result do you think is the most convincing piece of evidence pointing to X-linkage of the eye color gene? Explain your answer.

Q: In his original studies of Figure 3.18, Morgan first

In his original studies of Figure 3.18, Morgan first suggested that the original white-eyed male had two copies of the white-eye allele. In this problem, let’s assume that he meant t...

Q: How would you set up crosses to determine if a gene is

How would you set up crosses to determine if a gene is Y-linked versus X-linked?

Q: Occasionally during meiosis, a mistake can happen whereby a gamete may

Occasionally during meiosis, a mistake can happen whereby a gamete may receive zero or two sex chromosomes rather than one. Bridges made a cross between white-eyed female flies and red-eyed male flies...

Q: Let’s suppose that you have made a karyotype of a female fruit

Let’s suppose that you have made a karyotype of a female fruit fly with red eyes and found that it has three X chromosomes instead of the normal two. Although you do not know its par...

Q: With regard to thickness and length, what do you think chromosomes

With regard to thickness and length, what do you think chromosomes would look like if you microscopically examined them during interphase? How would that compare with their appearance during metaphase...

Q: White-eyed flies have a lower survival rate than red-

White-eyed flies have a lower survival rate than red-eyed flies. Based on the data in Figure 3.18, what percentage of white-eyed flies survived compared with red-eyed flies, assuming 100% survival of...

Q: A rare form of dwarfism that also included hearing loss was found

A rare form of dwarfism that also included hearing loss was found to run in a particular family. It is inherited as a dominant trait. It was discovered that an affected individual had one normal copy...

Q: Mexican hairless dogs have little hair and few teeth. When a

Mexican hairless dogs have little hair and few teeth. When a Mexican hairless is mated to another breed of dog, about half of the puppies are hairless. When two Mexican hairless dogs are mated to each...

Q: In a species of plant, two genes control flower color.

In a species of plant, two genes control flower color. The red allele (R) is dominant to the white allele (r); the color-producing allele (C) is dominant to the non-color-producing allele (c). You sus...

Q: Why are the homologous regions of the X and Y chromosome important

Why are the homologous regions of the X and Y chromosome important during meiosis?

Q: Red eyes is the wild-type phenotype in Drosophila, and

Red eyes is the wild-type phenotype in Drosophila, and several different genes (with each gene existing in two or more alleles) affect eye color. One allele causes purple eyes, and a different allele...

Q: In chickens, some varieties have feathered shanks (legs), but

In chickens, some varieties have feathered shanks (legs), but others do not. In a cross between a Black Langhans (feathered shanks) and a Buff Rocks (unfeathered shanks), the shanks of the F1 generati...

Q: In sheep, the formation of horns is a sex-influenced

In sheep, the formation of horns is a sex-influenced trait; the allele that results in horns is dominant in males and recessive in females. Females must be homozygous for the horned allele to have hor...

Q: A particular breed of dog can have long hair or short hair

A particular breed of dog can have long hair or short hair. When true-breeding long-haired animals were crossed to true-breeding short-haired animals, the offspring all had long hair. The F2 generatio...

Q: In the clover butterfly, males are always yellow, but females

In the clover butterfly, males are always yellow, but females can be yellow or white. In females, white is a dominant allele. Two yellow butterflies were crossed to yield an F1 generation consisting o...

Q: The Mic2 gene in humans is present on both the X and

The Mic2 gene in humans is present on both the X and Y chromosome. Let’s suppose the Mic2 gene exists in a dominant Mic2 allele, which results in normal surface antigen production, and a recessive mic...

Q: Duroc Jersey pigs are typically red, but a sandy variation is

Duroc Jersey pigs are typically red, but a sandy variation is also seen. When two different varieties of true-breeding sandy pigs were crossed to each other, they produced F1 offspring that were red....

Q: As shown in Figure 4.17, coat color in rodents

As shown in Figure 4.17, coat color in rodents is governed by a gene interaction. An albino rat is crossed to a black rat. The ratio of their offspring is 1 agouti : 1 black : 2 albino. What are the g...

Q: Summer squash exist in long, spherical, or disk shapes.

Summer squash exist in long, spherical, or disk shapes. When a true-breeding long-shaped strain was crossed to a true-breeding disk-shaped strain, all of the F1 offspring were disk-shaped. When the F1...

Q: Figure 5.1 describes an example of a maternal effect gene

Figure 5.1 describes an example of a maternal effect gene. Explain how Sturtevant deduced a maternal effect gene based on the F2 and F3 generations. From Figure 5.1:

Q: Explain how the use of radiolabeled amino acids in this procedure helped

Explain how the use of radiolabeled amino acids in this procedure helped to reveal the genetic code.

Q: What is the phenotype of a female cow that is heterozygous?

What is the phenotype of a female cow that is heterozygous?

Q: Chapter 21 describes a blotting method known as Northern blotting that is

Chapter 21 describes a blotting method known as Northern blotting that is used to determine the amount of mRNA produced by a particular gene. In this method, the amount of a specific mRNA produced by...

Q: A variegated trait in plants is analyzed using reciprocal crosses. The

A variegated trait in plants is analyzed using reciprocal crosses. The following results are obtained:

Q: As mentioned in Experimental Question E11, red eyes is the wildtype

As mentioned in Experimental Question E11, red eyes is the wildtype phenotype. Several different genes (with each gene existing in two or more alleles) are known to affect eye color. One allele causes...

Q: Let’s suppose you were looking through a vial of fruit flies in

Let’s suppose you were looking through a vial of fruit flies in your laboratory and noticed a male fly with pink eyes. What crosses would you make to determine if the pink allele is an X-linked gene?...

Q: When examining a human pedigree, what features do you look for

When examining a human pedigree, what features do you look for to distinguish between X-linked recessive inheritance and autosomal recessive inheritance? How would you distinguish X-linked dominant in...

Q: A cross was made between two strains of plants that are agriculturally

A cross was made between two strains of plants that are agriculturally important. One strain was disease-resistant but herbicide-sensitive; the other strain was disease-sensitive but herbicide-resista...

Q: What is a genetic cross?

What is a genetic cross?

Q: The technique known as DNA sequencing (described in Chapter 21)

The technique known as DNA sequencing (described in Chapter 21) enables researchers to determine the DNA sequence of genes. Would this technique be used primarily by transmission geneticists, molecula...

Q: Figure 1.5 shows a micrograph of chromosomes from a normal

Figure 1.5 shows a micrograph of chromosomes from a normal human cell. If you created this kind of image using a cell from a person with Down syndrome, what would you expect to see? From Figure 1.5:...

Q: Many organisms are studied by geneticists. Do you think each of

Many organisms are studied by geneticists. Do you think each of the following species would be more likely to be studied by a transmission geneticist, a molecular geneticist, or a population geneticis...

Q: What is the molecular explanation for sex-limited inheritance?

What is the molecular explanation for sex-limited inheritance?

Q: Discuss the types of experimental observations that Mary Lyon brought together in

Discuss the types of experimental observations that Mary Lyon brought together in proposing her hypothesis concerning X-chromosome inactivation. In your own words, explain how these observations were...

Q: Pick any trait you like in any species of wild plant or

Pick any trait you like in any species of wild plant or animal. The trait must somehow vary among different members of the species (see Figure 1.7). Note: When picking a trait to answer this question,...

Q: Describe three advantages of using pea plants as an experimental organism.

Describe three advantages of using pea plants as an experimental organism.

Q: Chapter 21 describes two blotting methods (i.e., Northern

Chapter 21 describes two blotting methods (i.e., Northern blotting and Western blotting) used to detect gene products. Northern blotting detects RNA and Western blotting detects proteins. Suppose that...

Q: As a hypothetical example, a trait in mice results in abnormally

As a hypothetical example, a trait in mice results in abnormally long tails. You initially have a true-breeding strain with normal tails and a true-breeding strain with long tails. You then make the f...

Q: You have a female snail that coils to the right, but

You have a female snail that coils to the right, but you do not know its genotype. You may assume that right coiling (D) is dominant to left coiling (d). You also have male snails of known genotype. H...

Q: On a camping trip, you find one male snail on a

On a camping trip, you find one male snail on a deserted island that coils to the right. However, in this same area, you find several shells (not containing living snails) that coil to the left. There...

Q: Figure 5.6 describes the results of X-chromosome inactivation

Figure 5.6 describes the results of X-chromosome inactivation in mammals. If fast and slow alleles of glucose-6-phosphate dehydrogenase (G-6-PD) exist in other species, what would be the expected resu...

Q: Two male mice, which we will call male A and male

Two male mice, which we will call male A and male B, are both phenotypically normal. Male A was from a litter that contained half phenotypically normal mice and half dwarf mice. The mother of male A w...

Q: In the experiment of Figure 5.6, why does a

In the experiment of Figure 5.6, why does a clone of cells produce only one type of G-6-PD enzyme? What would you expect to happen if a clone was derived from an early embryonic cell? Why does the ini...

Q: Why do you think the heterozygote offspring of two Manx cats survives

Why do you think the heterozygote offspring of two Manx cats survives with developmental abnormalities, whereas the homozygote dies?

Q: Figure 6.1 shows the first experimental results that indicated linkage

Figure 6.1 shows the first experimental results that indicated linkage between two different genes. Conduct a chi square analysis to confirm that the genes are really linked and the data could not be...

Q: Two genes in tomatoes are 61 mu apart; normal fruit (

Two genes in tomatoes are 61 mu apart; normal fruit (F) is dominant to fasciated (flattened) fruit ( f ), and normal number of leaves (Lf ) is dominant to leafy (lf ). A true-breeding plant with norma...

Q: In the tomato, three genes are linked on the same chromosome

In the tomato, three genes are linked on the same chromosome. Tall is dominant to dwarf, skin that is smooth is dominant to skin that is peachy, and fruit with a normal rounded tomato shape is dominan...

Q: A trait in garden peas involves the curling of leaves. A

A trait in garden peas involves the curling of leaves. A two-factor cross was made by crossing a plant with yellow pods and curling leaves to a wild-type plant with green pods and normal leaves. All F...

Q: In mice, the gene that encodes the enzyme inosine triphosphatase is

In mice, the gene that encodes the enzyme inosine triphosphatase is 12 mu from the gene that encodes the enzyme ornithine decarboxylase. Suppose you have identified a strain of mice homozygous for a d...

Q: In the garden pea, several different genes affect pod characteristics.

In the garden pea, several different genes affect pod characteristics. A gene affecting pod color (green is dominant to yellow) is approximately 7 mu away from a gene affecting pod width (wide is domi...

Q: A sex-influenced trait is dominant in males and causes bushy

A sex-influenced trait is dominant in males and causes bushy tails. The same trait is recessive in females. Fur color is not sex influenced. Yellow fur is dominant to white fur. A true-breeding female...

Q: Three recessive traits in garden pea plants are as follows: yellow

Three recessive traits in garden pea plants are as follows: yellow pods are recessive to green pods, bluish green seedlings are recessive to green seedlings, creeper (a plant that cannot stand up) is...

Q: In the experiment of Figure 6.6, Stern followed the

In the experiment of Figure 6.6, Stern followed the inheritance pattern in which females carried two abnormal X chromosomes to correlate genetic recombination with the physical exchange of chromosome...

Q: Explain the rationale behind a testcross. Is it necessary for one

Explain the rationale behind a testcross. Is it necessary for one of the parents to be homozygous recessive for the genes of interest? In the heterozygous parent of a testcross, must all of the domina...

Q: Does a PP individual produce more of the protein encoded by the

Does a PP individual produce more of the protein encoded by the P gene than is necessary for the purple color?

Q: In your own words, explain why a testcross cannot produce more

In your own words, explain why a testcross cannot produce more than 50% recombinant offspring. When a testcross does produce 50% recombinant offspring, what does this result mean?

Q: Explain why the percentage of recombinant offspring in a testcross is a

Explain why the percentage of recombinant offspring in a testcross is a more accurate measure of map distance when two genes are close together. When two genes are far apart, is the percentage of reco...

Q: If two genes are more than 50 mu apart, how would

If two genes are more than 50 mu apart, how would you ever be able to show experimentally that they are located on the same chromosome?

Q: In Morgan’s three-factor crosses of Figure 6.3,

In Morgan’s three-factor crosses of Figure 6.3, he realized that crossing over was more frequent between the eye color and wing length genes than between the body color and eye color...

Q: Two genes are located on the same chromosome and are known to

Two genes are located on the same chromosome and are known to be 12 mu apart. An AABB individual was crossed to an aabb individual to produce AaBb offspring. The AaBb offspring were then testcrossed t...

Q: Two genes, designated A and B, are located 10 mu

Two genes, designated A and B, are located 10 mu from each other. A third gene, designated C, is located 15 mu from B and 5 mu from A. The parental generation consisting of AA bb CC and aa BB cc indiv...

Q: In the experiment of Figure 7.1, a met−

In the experiment of Figure 7.1, a met− bio− thr+ leu+ thi+ cell could become met+ bio+ thr+ leu+ thi+ by a (rare) double mutation that converts the metâˆ...

Q: In the experiment of Figure 7.1, Lederberg and Tatum

In the experiment of Figure 7.1, Lederberg and Tatum could not discern whether met+ bio+ genetic material was transferred to the met− bio− thr+ leu+ thi+ strain or...

Q: Explain how a U-tube apparatus can distinguish between genetic transfer

Explain how a U-tube apparatus can distinguish between genetic transfer involving conjugation and genetic transfer involving transduction. Do you think a U-tube could be used to distinguish between tr...

Q: What is an interrupted mating experiment? What type of experimental information

What is an interrupted mating experiment? What type of experimental information can be obtained from this type of study? Why is it necessary to interrupt mating?

Q: Which individual(s) in this pedigree exhibit(s)

Which individual(s) in this pedigree exhibit(s) the effect of incomplete penetrance?

Q: In a conjugation experiment, what is meant by the time of

In a conjugation experiment, what is meant by the time of entry? How is the time of entry determined experimentally?

Q: In your laboratory, you have an F− strain of E

In your laboratory, you have an F− strain of E. coli that is resistant to streptomycin and is unable to metabolize lactose, but it can metabolize glucose. Therefore, this strain can grow on a medium t...

Q: As mentioned in question 2 of More Genetic TIPS, origins of

As mentioned in question 2 of More Genetic TIPS, origins of transfer can be located in many different locations, and their direction of transfer can be clockwise or counterclockwise. Letâ€&...

Q: An Hfr strain that is hisE+ and pheA+ was mixed

An Hfr strain that is hisE+ and pheA+ was mixed with a strain that is hisE− and pheA−. The conjugation was interrupted and the percentage of recombinants for each g...

Q: What is the main goal of comparative genome hybridization? Explain how

What is the main goal of comparative genome hybridization? Explain how the ratio of green to red fluorescence provides information about chromosome structure.

Q: Let’s suppose a researcher conducted comparative genomic hybridization (see Figure 8

Let’s suppose a researcher conducted comparative genomic hybridization (see Figure 8.9) and accidentally added twice as much DNA from normal cells (labeled with red fluorescence) relative to DNA from...

Q: With regard to the analysis of chromosome structure, explain the experimental

With regard to the analysis of chromosome structure, explain the experimental advantage that polytene chromosomes offer. Discuss why changes in chromosome structure are more easily detected in polyten...

Q: Describe how colchicine can be used to alter chromosome number.

Describe how colchicine can be used to alter chromosome number.

Q: Describe the steps you would take to produce a tetraploid plant from

Describe the steps you would take to produce a tetraploid plant from a diploid plant.

Q: It is an exciting time to be a plant breeder because so

It is an exciting time to be a plant breeder because so many options are available for the development of new types of agriculturally useful plants. Let’s suppose you wish to develop a seedless tomato...

Q: What are the two main factors that determine an organism’s traits?

What are the two main factors that determine an organism’s traits?

Q: Genetic material acts as a blueprint for an organism’s traits. Explain

Genetic material acts as a blueprint for an organism’s traits. Explain how Griffith’s experiments indicated that genetic material was being transferred to the type R bacteria.

Q: With regard to the experiment described in Figure 9.2,

With regard to the experiment described in Figure 9.2, answer the following: A. List several possible reasons why only a small percentage of the type R bacteria was converted to type S. B. Explain w...

Q: An interesting trait that some bacteria exhibit is resistance to being killed

An interesting trait that some bacteria exhibit is resistance to being killed by antibiotics. For example, certain strains of bacteria are resistant to tetracycline, whereas other strains are sensitiv...

Q: The type of model building used by Pauling and by Watson and

The type of model building used by Pauling and by Watson and Crick involved the use of ball-and-stick units. Now we can do model building on a computer screen. Even though you may not be familiar with...

Q: With regard to Chargaff’s experiment described in Figure 9.10,

With regard to Chargaff’s experiment described in Figure 9.10, answer the following: A. What is the purpose of paper chromatography? B. Explain why it is necessary to remove the ba...

Q: Gierer and Schramm exposed plant tissue to purified RNA from tobacco mosaic

Gierer and Schramm exposed plant tissue to purified RNA from tobacco mosaic virus, and the plants developed the same types of lesions as if they had been exposed to the virus itself. What would be the...

Q: What are G bands? Discuss how G bands are useful in

What are G bands? Discuss how G bands are useful in the analysis of chromosome structure.

Q: A female fruit fly has one normal X chromosome and one X

A female fruit fly has one normal X chromosome and one X chromosome with a deletion. The deletion occurred in the middle of the X chromosome and removed about 10% of the entire length of the X chromos...

Q: Acridine orange is a chemical that inhibits the replication of F-

Acridine orange is a chemical that inhibits the replication of F-factor DNA but does not affect the replication of chromosomal DNA, even if the chromosomal DNA contains an Hfr. Let’s suppose that you...

Q: Two circular DNA molecules, which we can call molecule A and

Two circular DNA molecules, which we can call molecule A and molecule B, are topoisomers of each other. When viewed under the electron microscope, molecule A appears more compact than molecule B. The...

Q: At the molecular level, what is the explanation for why the

At the molecular level, what is the explanation for why the four-o’clock flowers are pink instead of red?

Q: Let’s suppose you have isolated DNA from a cell and viewed it

Let’s suppose you have isolated DNA from a cell and viewed it under a microscope. It looks supercoiled. What experiment would you perform to determine if it is positively or negatively supercoiled? In...

Q: We seem to know more about the structure of eukaryotic chromosomal DNA

We seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss why you think this is so, and list several experimental procedures that have yielded important inform...

Q: In Noll’s experiment of Figure 10.11, explain where DNase

In Noll’s experiment of Figure 10.11, explain where DNase I cuts the DNA. Why were the bands on the gel in multiples of 200 bp at lower DNase I concentrations? From Figure 10.11:

Q: When chromatin is treated with a salt solution of moderate concentration,

When chromatin is treated with a salt solution of moderate concentration, the linker histone H1 is removed. A higher salt concentration removes the rest of the histone proteins. If the experiment of F...

Q: Let’s suppose you have isolated chromatin from some bizarre eukaryote with a

Let’s suppose you have isolated chromatin from some bizarre eukaryote with a linker region that is usually 300–350 bp in length. The nucleosome structure is the same as in other eukaryotes. If you dig...

Q: Answer the following questions pertaining to the experiment of Figure 11.

Answer the following questions pertaining to the experiment of Figure 11.3. A. What would be the expected results if the Meselson and Stahl experiment were carried out for four or five generations?...

Q: An absentminded researcher follows the steps of Figure 11.3,

An absentminded researcher follows the steps of Figure 11.3, and when the gradient is viewed under UV light, the researcher does not see any bands at all. Which of the following mistakes could account...

Q: Figure 11.4b shows an autoradiograph of a replicating bacterial chromosome

Figure 11.4b shows an autoradiograph of a replicating bacterial chromosome. If you analyzed many replicating chromosomes, what types of information could you learn about the mechanism of DNA replicati...

Q: As described in Table 11.3, what is the difference

As described in Table 11.3, what is the difference between a rapidstop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants? From Fi...

Q: The technique of dideoxy sequencing of DNA is described in Chapter 21

The technique of dideoxy sequencing of DNA is described in Chapter 21. The technique relies on the use of dideoxyribonucleotides. A dideoxyribonucleotide has a hydrogen atom attached to the 3′ carbon...

Q: At which level is incomplete dominance more likely to be observed—

At which level is incomplete dominance more likely to be observed—at the molecular/cellular level or at the organism level?

Q: Another technique described in Chapter 21 is polymerase chain reaction (PCR

Another technique described in Chapter 21 is polymerase chain reaction (PCR) which is based on our understanding of DNA replication. In this method, a small amount of double-stranded template DNA is m...

Q: A research group has sequenced the cDNA and genomic DNA for a

A research group has sequenced the cDNA and genomic DNA for a particular gene. The cDNA is derived from mRNA, so it does not contain introns. Here are the DNA sequences. cDNA: 5′&ac...

Q: Chapter 21 describes a technique known as Northern blotting that is used

Chapter 21 describes a technique known as Northern blotting that is used to detect RNA transcribed from a particular gene. In this method, a specific RNA is detected using a short segment of cloned DN...

Q: An electrophoretic mobility shift assay (EMSA) can be used to

An electrophoretic mobility shift assay (EMSA) can be used to study the binding of proteins to a segment of DNA. This method is described in Chapter 21. When a protein binds to a segment of DNA, it sl...

Q: As described in Chapter 21 and in experimental question E3, an

As described in Chapter 21 and in experimental question E3, an electrophoretic mobility shift assay can be used to determine if a protein binds to DNA. This method can also determine if a protein bind...

Q: The technique of DNase I footprinting is described in Chapter 21.

The technique of DNase I footprinting is described in Chapter 21. If a protein binds over a region of DNA, it will protect the DNA in that region from digestion by DNase I. To carry out a DNase I foot...

Q: Researchers are often interested in focusing their attention on the transcription of

Researchers are often interested in focusing their attention on the transcription of protein-encoding genes in eukaryotes. Such researchers want to study mRNA. One method that is used to isolate mRNA...

Q: If you were given a sample of chromosomal DNA and asked to

If you were given a sample of chromosomal DNA and asked to determine if it is bacterial or eukaryotic, what experiment would you perform, and what would be your expected results?

Q: Consider how histone proteins bind to DNA and then explain why a

Consider how histone proteins bind to DNA and then explain why a high salt concentration can remove histones from DNA (as shown in Figure 10.18b). From Figure 10.18b:

Q: Discuss why you think the ribosomes need to contain so many proteins

Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?

Q: Why does the heterozygote have an advantage?

Why does the heterozygote have an advantage?

Q: Discuss and make a list of the similarities and differences in the

Discuss and make a list of the similarities and differences in the events that occur during the initiation, elongation, and termination stages of transcription (see Chapter 12) and translation discuss...

Q: Which events during translation involve molecular recognition between base sequences within different

Which events during translation involve molecular recognition between base sequences within different RNAs? Which events involve recognition between different protein molecules?

Q: Discuss how variation in chromosome number has been useful in agriculture.

Discuss how variation in chromosome number has been useful in agriculture.

Q: A cross was made between two pea plants, TtAa and Ttaa

A cross was made between two pea plants, TtAa and Ttaa, where T = tall, t = dwarf, A = axial, and a = terminal. What is the probability that the first three offspring will be tall with axial flowers o...

Q: Consider this four-factor cross: Tt Rr yy Aa ×

Consider this four-factor cross: Tt Rr yy Aa × Tt RR Yy aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal. What is the probability that the first t...

Q: In Figure 3.18, Morgan obtained a white-eyed

In Figure 3.18, Morgan obtained a white-eyed male fly in a population containing many red-eyed flies that he thought were true-breeding. As mentioned in the experiment, he crossed this fly with severa...

Q: A diploid eukaryotic cell has 10 chromosomes (5 per set).

A diploid eukaryotic cell has 10 chromosomes (5 per set). As a group, take turns having one student draw the cell as it would look during a phase of mitosis, meiosis I, or meiosis II; then have the ot...

Q: Let’s suppose a gene exists as a functional wild-type allele

Let’s suppose a gene exists as a functional wild-type allele and a nonfunctional mutant allele. At the organism level (i.e., at the level of visible traits), the wild-type allele is dominant. In a het...

Q: In oats, the color of the chaff is determined by a

In oats, the color of the chaff is determined by a two-gene interaction. When a true-breeding black chaff plant was crossed to a true-breeding white chaff plant, the F1 generation was composed of all...

Q: Recessive maternal effect genes are identified in flies (for example)

Recessive maternal effect genes are identified in flies (for example) when a phenotypically normal mother cannot produce any normal offspring. Because all of the offspring are dead, this female fly ca...

Q: Which of these three scenarios explains overdominance with regard to the sickle

Which of these three scenarios explains overdominance with regard to the sickle cell allele? From Figure 4.8:

Q: According to the endosymbiosis theory, mitochondria and chloroplasts are derived from

According to the endosymbiosis theory, mitochondria and chloroplasts are derived from bacteria that took up residence within eukaryotic cells. At one time, prior to being taken up by eukaryotic cells,...

Q: Discuss the principles of the chromosome theory of inheritance. Which principles

Discuss the principles of the chromosome theory of inheritance. Which principles were deduced via light microscopy, and which were deduced from crosses? What modern techniques could be used to support...

Q: In mice, a dominant allele that causes a short tail is

In mice, a dominant allele that causes a short tail is located on chromosome 2. On chromosome 3, a recessive allele causing droopy ears is 6 mu away from another recessive allele that causes a flaky t...

Q: In Chapter 3, we discussed the idea that the X and

In Chapter 3, we discussed the idea that the X and Y chromosomes have a few genes in common. These genes are inherited in a pseudoautosomal pattern. With this phenomenon in mind, discuss whether or no...

Q: Discuss the advantages of the genetic analysis of bacteria. Make a

Discuss the advantages of the genetic analysis of bacteria. Make a list of the types of allelic differences among bacteria that are suitable for genetic analyses.

Q: Of the three types of genetic transfer, discuss which one(

Of the three types of genetic transfer, discuss which one(s) is/are more likely to occur between members of different species. Discuss some of the potential consequences of interspecies genetic transf...

Q: Mendel studied seven traits in pea plants, and the garden pea

Mendel studied seven traits in pea plants, and the garden pea happens to have seven different chromosomes. It has been pointed out that Mendel was very lucky not to have conducted crosses involving tw...

Q: Consider this cross in pea plants: Tt Rr yy Aa ×

Consider this cross in pea plants: Tt Rr yy Aa × Tt rr Yy Aa, where T = tall, t = dwarf, R = round, r = wrinkled, Y = yellow, y = green, A = axial, a = terminal. What is the expected phenotypic outcom...

Q: A chromosome that was involved in a reciprocal translocation also has an

A chromosome that was involved in a reciprocal translocation also has an inversion. In addition, the cell contains two normal chromosomes. Make a drawing that shows how these chromosomes will pair du...

Q: Besides the ones mentioned in this textbook, look for other examples

Besides the ones mentioned in this textbook, look for other examples of variations in euploidy. Perhaps you might look in more advanced textbooks concerning population genetics, ecology, etc. Discuss...

Q: What are the two key functional sites of a tRNA molecule?

What are the two key functional sites of a tRNA molecule?

Q: Which allele is an example of a loss-of-function

Which allele is an example of a loss-of-function allele?

Q: Try to propose structures for a genetic material that are substantially different

Try to propose structures for a genetic material that are substantially different from the double helix. Remember that the genetic material must have a way to store information and a way to be faithfu...

Q: How might you provide evidence that DNA is the genetic material in

How might you provide evidence that DNA is the genetic material in mice?

Q: Cell biology textbooks often discuss cellular proteins encoded by genes that are

Cell biology textbooks often discuss cellular proteins encoded by genes that are members of a gene family. Examples of such proteins include myosins and glucose transporters. Look through a cell biolo...

Q: Bacterial and eukaryotic chromosomes are very compact. Discuss the advantages and

Bacterial and eukaryotic chromosomes are very compact. Discuss the advantages and disadvantages of a compact chromosomal structure.

Q: The prevalence of highly repetitive sequences seems rather strange to many geneticists

The prevalence of highly repetitive sequences seems rather strange to many geneticists. Do they seem strange to you? Why or why not? Discuss whether or not you think they have an important function.

Q: Discuss and make a list of the similarities and differences between bacterial

Discuss and make a list of the similarities and differences between bacterial and eukaryotic chromosomes.

Q: The complementarity of its two strands is the underlying reason that DNA

The complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.

Q: Compare and contrast DNA replication in bacteria and eukaryotes.

Compare and contrast DNA replication in bacteria and eukaryotes.

Q: Based on your knowledge of introns and pre-mRNA splicing,

Based on your knowledge of introns and pre-mRNA splicing, discuss whether or not you think alternative splicing fully explains the existence of introns. Can you think of other possible reasons to expl...

Q: Discuss the types of RNA transcripts and the functional roles they play

Discuss the types of RNA transcripts and the functional roles they play. Why do you think some RNAs form complexes with protein subunits?

Q: Explain why all of the offspring in the F2 generation are dextral

Explain why all of the offspring in the F2 generation are dextral even though some of them are dd.

Q: DNA replication is fast, virtually error-free, and coordinated

DNA replication is fast, virtually error-free, and coordinated with cell division. Discuss which of these three features you think is the most important.

Q: Which types of offspring are found in excess in the F2 generation

Which types of offspring are found in excess in the F2 generation, based on Mendel’s law of independent assortment?

Q: What phenomenon explains why the maximum percentage of recombinant offspring does not

What phenomenon explains why the maximum percentage of recombinant offspring does not exceed 50%?

Q: How do the wobble rules affect the total number of different tRNAs

How do the wobble rules affect the total number of different tRNAs that are needed to carry out translation?

Q: Does mitotic recombination occur in a gamete (sperm or egg cell

Does mitotic recombination occur in a gamete (sperm or egg cell) or in a somatic cell?

Q: Describe how genetic transfer can explain the growth of colonies on the

Describe how genetic transfer can explain the growth of colonies on the middle plate.

Q: If these two genes were very far apart on the bacterial chromosome

If these two genes were very far apart on the bacterial chromosome, how would the results have been different?

Q: If the recipient cell did not already have a lys− gene

If the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.

Q: Why do mitochondria need genes that encode rRNAs and tRNAs?

Why do mitochondria need genes that encode rRNAs and tRNAs?

Q: What is a reciprocal cross?

What is a reciprocal cross?

Q: During growth, can a patch of tissue with a white phenotype

During growth, can a patch of tissue with a white phenotype give rise to a patch with a green phenotype? Explain.

Q: How have chloroplasts and mitochondria changed since the initial endosymbiosis events,

How have chloroplasts and mitochondria changed since the initial endosymbiosis events, which occurred hundreds of millions of years ago?

Q: On the left side of this figure, explain why the offspring

On the left side of this figure, explain why the offspring TABLE 5.2 does not have Prader-Willi syndrome but does have Angelman syndrome. From Table 5.2:

Q: With regard to studying the mechanism of conjugation, what is the

With regard to studying the mechanism of conjugation, what is the purpose of using a U-tube?

Q: Would this circular DNA molecule be found in an F+ or

Would this circular DNA molecule be found in an F+ or F− cell?

Q: If a mother snail is heterozygous, Dd, which gene products

If a mother snail is heterozygous, Dd, which gene products will the oocyte receive?

Q: Why is the Barr body more brightly staining in a cell nucleus

Why is the Barr body more brightly staining in a cell nucleus than the other chromosomes?

Q: At which stage of development does XCI initially occur?

At which stage of development does XCI initially occur?

Q: Why do these two forms of G-6-PD migrate

Why do these two forms of G-6-PD migrate differently?

Q: Which of the phases of XCI occurs in an adult female?

Which of the phases of XCI occurs in an adult female?

Q: What would be the outcome of a cross between a heterozygous female

What would be the outcome of a cross between a heterozygous female and a male that carries two normal copies of the Igf2 gene?

Q: Explain why the erasure phase of imprinting is necessary in eggs.

Explain why the erasure phase of imprinting is necessary in eggs.

Q: What is the difference between maintenance methylation and de novo methylation?

What is the difference between maintenance methylation and de novo methylation? In what cell types (somatic cells or germ-line cells) does each process occur?

Q: How is a nucleoid different from a cell nucleus?

How is a nucleoid different from a cell nucleus?

Q: What is the difference between a charged tRNA and an uncharged tRNA

What is the difference between a charged tRNA and an uncharged tRNA?

Q: If a crossover began in the short region between gene A and

If a crossover began in the short region between gene A and the tip of the chromosome, would this event affect the arrangement of the A and B alleles?

Q: Of the eight possible phenotypic combinations in the F2 generation, which

Of the eight possible phenotypic combinations in the F2 generation, which ones are the product of a single crossover?

Q: Why are the nonrecombinant offspring more common than the recombinant offspring?

Why are the nonrecombinant offspring more common than the recombinant offspring?

Q: Why are the types of offspring described in part (b)

Why are the types of offspring described in part (b) of Figure 6.5 more numerous than those described in part (c)? From Figure 6.5b: From Figure 6.5c:

Q: List five reasons why genetic maps are useful.

List five reasons why genetic maps are useful.

Q: When and in which fly or flies did crossing over occur in

When and in which fly or flies did crossing over occur in order to produce the F2 recombinant offspring?

Q: Does this figure illustrate a strength or a drawback of using morphological

Does this figure illustrate a strength or a drawback of using morphological traits to establish species? From Figure 29.1:

Q: With regard to phylogenetic trees, how is a molecular clock useful

With regard to phylogenetic trees, how is a molecular clock useful?

Q: What feature(s) of this pedigree indicate(s)

What feature(s) of this pedigree indicate(s) dominant inheritance?

Q: What feature(s) of this pedigree indicate(s)

What feature(s) of this pedigree indicate(s) X-linked recessive inheritance?

Q: What is a haplotype?

What is a haplotype?

Q: Explain the connection between the founder and the G8-C marker

Explain the connection between the founder and the G8-C marker.

Q: Where does the prion protein come from?

Where does the prion protein come from?

Q: How would a mutation that prevents the Ras protein from hydrolyzing GTP

How would a mutation that prevents the Ras protein from hydrolyzing GTP affect the cell-signaling pathway in Figure 25.11? From Figure 25.11:

Q: Why does this translocation cause leukemia rather than cancer in a different

Why does this translocation cause leukemia rather than cancer in a different tissue type, such as the lung?

Q: If a cell cannot make any Rb protein, how will this

If a cell cannot make any Rb protein, how will this affect the function of E2F?

Q: Explain how this experiment provides information regarding the expression of genes.

Explain how this experiment provides information regarding the expression of genes. From Figure 24.1:

Q: How does the binding of a protein to DNA influence the ability

How does the binding of a protein to DNA influence the ability of DNase I to cleave the DNA?

Q: Describe two differences among these chromosomes.

Describe two differences among these chromosomes.

Q: Explain why cuts are made on both sides of the damaged region

Explain why cuts are made on both sides of the damaged region of the DNA.

Q: Which of the three Mut proteins is responsible for ensuring that the

Which of the three Mut proteins is responsible for ensuring that the mismatched base in the newly made daughter strand is the one that is removed?

Q: What is an advantage and a disadvantage of this repair system?

What is an advantage and a disadvantage of this repair system?

Q: Why is an antibody used in this experiment? From

Why is an antibody used in this experiment? From figure 24.2:

Q: Explain how these mechanisms affect protein diversity.

Explain how these mechanisms affect protein diversity.

Q: What is the purpose of tandem mass spectrometry?

What is the purpose of tandem mass spectrometry?

Q: Explain why the sequences of these two genes are similar to each

Explain why the sequences of these two genes are similar to each other but not identical.

Q: Why is this technique used?

Why is this technique used?

Q: Is this a sequencing by synthesis method? Explain.

Is this a sequencing by synthesis method? Explain.

Q: Which portion of a T-DNA vector is transferred to a

Which portion of a T-DNA vector is transferred to a plant?

Q: What are two common applications of DNA fingerprinting?

What are two common applications of DNA fingerprinting?

Q: What are advantages and disadvantages of these two methods?

What are advantages and disadvantages of these two methods? From figure 22.15:

Q: Which of these mechanisms involve(s) diffusible morphogens?

Which of these mechanisms involve(s) diffusible morphogens?

Q: Briefly describe how the HoxC-6 gene affects vertebrate development.

Briefly describe how the HoxC-6 gene affects vertebrate development.

Q: At which stage of development does the Id protein function? Why

At which stage of development does the Id protein function? Why is its function important?

Q: Why is it important to maintain the correct number of stem cells

Why is it important to maintain the correct number of stem cells in the growing tip?

Q: How does genetics play a role in development?

How does genetics play a role in development?

Q: Describe the orientations of the anteroposterior and dorsoventral axes.

Describe the orientations of the anteroposterior and dorsoventral axes.

Q: What is the normal function of the Bicoid protein?

What is the normal function of the Bicoid protein?

Q: Where are maternal-effect gene products made first? Where do

Where are maternal-effect gene products made first? Where do they go?

Q: Describe the difference in the effects of a mutation in a gap

Describe the difference in the effects of a mutation in a gap gene versus one in a pair-rule gene.

Q: What would be the expected result if gene A was inactive?

What would be the expected result if gene A was inactive?

Q: Explain how the physical arrangements of the homeotic genes correlate with their

Explain how the physical arrangements of the homeotic genes correlate with their effects on phenotype.

Q: What is a cell lineage?

What is a cell lineage?

Q: What is an ortholog?

What is an ortholog?

Q: What does the term local population mean?

What does the term local population mean?

Q: Are polymorphisms common or rare in natural populations?

Are polymorphisms common or rare in natural populations?

Q: With respect to this form of natural selection, explain the meaning

With respect to this form of natural selection, explain the meaning of the word directional.

Q: In this example, is directional selection promoting genetic diversity? Explain

In this example, is directional selection promoting genetic diversity? Explain.

Q: Explain why the HbS allele is prevalent in certain regions even though

Explain why the HbS allele is prevalent in certain regions even though it is detrimental in the homozygous condition.

Q: Explain how negative frequency-dependent selection works.

Explain how negative frequency-dependent selection works.

Q: Does this form of natural selection favor polymorphism? Explain why or

Does this form of natural selection favor polymorphism? Explain why or why not.

Q: What is an advantage of gene regulation?

What is an advantage of gene regulation?

Q: In general, why does stabilizing selection decrease genetic diversity?

In general, why does stabilizing selection decrease genetic diversity?

Q: Is height a discontinuous (discrete) trait, or does it

Is height a discontinuous (discrete) trait, or does it follow a continuum?

Q: What is happening at the bottleneck? Describe the effect of genetic

What is happening at the bottleneck? Describe the effect of genetic drift during the bottleneck.

Q: How does inbreeding affect the likelihood that recessive traits will be expressed

How does inbreeding affect the likelihood that recessive traits will be expressed? Explain.

Q: What percentage of individuals fall more than 2 SDs above the mean

What percentage of individuals fall more than 2 SDs above the mean?

Q: What does it mean to say that these alleles are additive?

What does it mean to say that these alleles are additive?

Q: Explain how gene number and environmental variation affect the overlaps between phenotypes

Explain how gene number and environmental variation affect the overlaps between phenotypes and different genotypes.

Q: What are the two ways that strains A and B differ?

What are the two ways that strains A and B differ?

Q: What are the similarities and differences between natural selection and selective breeding

What are the similarities and differences between natural selection and selective breeding?

Q: Discuss the types of traits that have been subjected to selective breeding

Discuss the types of traits that have been subjected to selective breeding in this example.

Q: Why is feedback inhibition an advantage to the bacterium?

Why is feedback inhibition an advantage to the bacterium?

Q: What are two reasons why a selection limit is reached in which

What are two reasons why a selection limit is reached in which artificial selection no longer has an effect?

Q: How does population size affect genetic drift?

How does population size affect genetic drift?

Q: Describe the two general types of protein microarrays. What are their

Describe the two general types of protein microarrays. What are their possible applications?

Q: Discuss the bioinformatics approaches that can be used to identify a protein

Discuss the bioinformatics approaches that can be used to identify a protein-encoding gene.

Q: What is a motif? Why is it useful for computer programs

What is a motif? Why is it useful for computer programs to identify functional motifs within amino acid sequences?

Q: Discuss why it is useful to search a database to identify sequences

Discuss why it is useful to search a database to identify sequences that are homologous to a newly determined sequence.

Q: In this chapter, we considered a computer program that can translate

In this chapter, we considered a computer program that can translate a DNA sequence into a polypeptide sequence. A researcher has a sequence file that contains the amino acid sequence of a polypeptide...

Q: Researchers have used the cloning methods described in Chapter 21 to clone

Researchers have used the cloning methods described in Chapter 21 to clone the bicoid gene and express large amounts of the Bicoid protein. The Bicoid protein was then injected into the posterior end...

Q: Two techniques commonly used to study the expression patterns of genes that

Two techniques commonly used to study the expression patterns of genes that play a role in development are Northern blotting and in situ hybridization. As described in Chapter 21, Northern blotting is...

Q: Explain one experimental strategy for determining the functional role of the mouse

Explain one experimental strategy for determining the functional role of the mouse HoxD-3 gene.

Q: Which RNA conformation favors transcription—the form with the antiterminator stem

Which RNA conformation favors transcription—the form with the antiterminator stem-loop or the form with the terminator stem-loop?

Q: In the experiment of Figure 26.16, suggest reasons why

In the experiment of Figure 26.16, suggest reasons why the n536, n355, and n540 strains have an egg-laying defect From Figure 26.16: Answer: An egg-laying defect is somehow related to an abnormal an...

Q: Another way to study the role of proteins (e.g

Another way to study the role of proteins (e.g., transcription factors) that function in development is to microinject the mRNA that encodes a protein, or the purified protein itself, into an oocyte o...

Q: Why have geneticists used reverse genetics to study the genes involved in

Why have geneticists used reverse genetics to study the genes involved in vertebrate development? Explain how this strategy differs from traditional genetic analyses like those done by Mendel.

Q: Below is a short nucleotide sequence from a gene. Use the

Below is a short nucleotide sequence from a gene. Use the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene s...

Q: Compare and contrast the experimental advantages of Drosophila and C. elegans

Compare and contrast the experimental advantages of Drosophila and C. elegans in the study of developmental genetics.

Q: What is meant by the term cell fate? What is a

What is meant by the term cell fate? What is a cell lineage diagram? Discuss the experimental advantage of having a cell lineage diagram. What is a cell lineage?

Q: Explain why a cell lineage diagram is necessary to determine if a

Explain why a cell lineage diagram is necessary to determine if a mutation is heterochronic.

Q: Explain the rationale behind the use of the “bag of worms

Explain the rationale behind the use of the “bag of worms” phenotype as a way to identify heterochronic mutations.

Q: Shown next are cell lineages determined from analyses of hypodermal cells in

Shown next are cell lineages determined from analyses of hypodermal cells in wild-type and mutant strains of C. elegans. Explain the nature of the mutations in the altered strains.

Q: Take a look at question 2 in More Genetic TIPS before answering

Take a look at question 2 in More Genetic TIPS before answering this question. Drosophila embryos carrying a ts mutation were exposed to the permissive (25°C) or nonpermissive (30Â&de...

Q: Which RNA conformation favors translation—the form with the Shine-

Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?

Q: All of the homeotic genes in Drosophila have been cloned. As

All of the homeotic genes in Drosophila have been cloned. As discussed in Chapter 21, cloned genes can be manipulated in vitro. They can be subjected to cutting and pasting, gene mutagenesis, etc. Aft...

Q: You need to understand question 3 in More Genetic TIPS before answering

You need to understand question 3 in More Genetic TIPS before answering this question. If the artificial gene containing the stripe 2 enhancer and the β-galactosidase gene were found within an embryo...

Q: You will need to be familiar with the techniques described in Chapter

You will need to be familiar with the techniques described in Chapter 21 to answer this question. Gene polymorphisms can be detected using a variety of cellular and molecular techniques. Which techniq...

Q: Among a large population of 2 million gray mosquitoes, one mosquito

Among a large population of 2 million gray mosquitoes, one mosquito is heterozygous for a body color gene; this mosquito has one gray allele and one blue allele. There is no selective advantage or dis...

Q: In a donor population, the allele frequencies for the common (

In a donor population, the allele frequencies for the common (HbA ) and sickle cell (HbS ) alleles are 0.9 and 0.1, respectively. A group of 550 individuals from this population migrates to another po...

Q: Look at question 5 in More Genetic TIPS before answering this question

Look at question 5 in More Genetic TIPS before answering this question. Here are traditional DNA fingerprints of five people: a child, the mother, and three potential fathers: Which males can be rule...

Q: What is DNA fingerprinting? How can it be used in human

What is DNA fingerprinting? How can it be used in human identification?

Q: When analyzing the automated DNA fingerprints of a father and his biological

When analyzing the automated DNA fingerprints of a father and his biological daughter, a technician examined 50 peaks and found that 30 of them were a perfect match. In other words, 30 out of 50 peaks...

Q: You will need to refer to question 2 in More Genetic TIPS

You will need to refer to question 2 in More Genetic TIPS to answer this question. The gene for coat color in rabbits can exist in four alleles termed C (full coat color), cch (chinchilla), c h (Himal...

Q: In a large herd of 5468 sheep, 76 animals have yellow

In a large herd of 5468 sheep, 76 animals have yellow fat, and the rest of the members of the herd have white fat. Yellow fat is inherited as a recessive trait. This herd is assumed to be in Hardy-Wei...

Q: Which genes are under the control of the lac promoter?

Which genes are under the control of the lac promoter?

Q: The human MN blood group is determined by two codominant alleles,

The human MN blood group is determined by two codominant alleles, M and N. The following data were obtained from five human populations: A. Calculate the allele frequencies in these five populations....

Q: You will need to refer to question 2 in More Genetic TIPS

You will need to refer to question 2 in More Genetic TIPS before answering this question. In an island population, the following data were obtained for the numbers of people with each of the four bloo...

Q: Resistance to the poison warfarin is a genetically determined trait in rats

Resistance to the poison warfarin is a genetically determined trait in rats. Homozygotes carrying the resistance allele (WR WR ) have a lower fitness because they suffer from vitamin K deficiency, but...

Q: Describe, in as much experimental detail as possible, how you

Describe, in as much experimental detail as possible, how you would test the hypothesis that the distribution of shell color among land snails is due to predation.

Q: In the Grants’ study of the medium ground finch, do you

In the Grants’ study of the medium ground finch, do you think the pattern of natural selection was directional, stabilizing, disruptive, or balancing? Explain your answer. If the environment remained...

Q: A recessive lethal allele has achieved a frequency of 0.22

A recessive lethal allele has achieved a frequency of 0.22 due to genetic drift in a very small population. Based on natural selection, how would you expect the allele frequencies to change in the nex...

Q: Here are data for height and weight among 10 male college students

Here are data for height and weight among 10 male college students. A. Calculate the correlation coefficient for height and weight for this group. B. Is the correlation coefficient statistically sig...

Q: A danger in computing heritability values from studies involving genetically related individuals

A danger in computing heritability values from studies involving genetically related individuals is the possibility that these individuals share more similar environments than do unrelated individuals...

Q: A large, genetically heterogeneous group of tomato plants was used as

A large, genetically heterogeneous group of tomato plants was used as the original breeding stock by two different breeders, named Mary and Hector. Each breeder was given 50 seeds and began an artific...

Q: For each of the following relationships, correlation coefficients for height were

For each of the following relationships, correlation coefficients for height were determined for 15 pairs of individuals: Mother-daughter: 0.36 Mother-granddaughter: 0.17 Sister-sister: 0.39 Sister...

Q: Under what conditions is lac repressor bound to the lac operon?

Under what conditions is lac repressor bound to the lac operon?

Q: An animal breeder had a herd of sheep with a mean weight

An animal breeder had a herd of sheep with a mean weight of 254 pounds at 3 years of age. He chose animals with a mean weight of 281 pounds as parents for the next generation. When these offspring rea...

Q: The trait of blood pressure in humans has a frequency distribution that

The trait of blood pressure in humans has a frequency distribution that is similar to a normal distribution. The following graph shows the ranges of blood pressures for a selected population of people...

Q: The abdomen length (in millimeters) was measured in 15 male

The abdomen length (in millimeters) was measured in 15 male Drosophila, and the following data were obtained: 1.9, 2.4, 2.1, 2.0, 2.2, 2.4, 1.7, 1.8, 2.0, 2.0, 2.3, 2.1, 1.6, 2.3, and 2.2. Calculate t...

Q: You conduct an RFLP analysis of head weight in one strain of

You conduct an RFLP analysis of head weight in one strain of cabbage; you determine that seven QTLs affect this trait. In another strain of cabbage, you find that only four QTLs affect this trait. Not...

Q: From an experimental viewpoint, what does it mean to say that

From an experimental viewpoint, what does it mean to say that an RFLP is associated with a trait? Let’s suppose that two strains of pea plants differ in two RFLPs that are linked to two genes governin...

Q: Let’s suppose that two strains of pigs differ in 500 RFLPs.

Let’s suppose that two strains of pigs differ in 500 RFLPs. One strain is much larger than the other. The pigs are crossed to each other, and the members of the F1 generation are also crossed among th...

Q: Outline the steps you would follow to determine the number of genes

Outline the steps you would follow to determine the number of genes that influence the yield of rice. Describe the results you might get if rice yield is governed by variation in six different genes....

Q: In a wild strain of tomato plants, the phenotypic variance for

In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2 g2. In another strain of highly inbred tomatoes raised under the same environmental conditions, the phenotypic varia...

Q: The average thorax length in a Drosophila population is 1.01

The average thorax length in a Drosophila population is 1.01 mm. You want to practice selective breeding to make larger Drosophila. To do so, you choose 10 parents (5 males and 5 females) of the follo...

Q: In a strain of mice, the average 6-week body

In a strain of mice, the average 6-week body weight is 25 g, and the narrow-sense heritability for this trait is 0.21. A. What would be the average weight of the offspring if parents with a mean weig...

Q: Which is more common anagenesis or cladogenesis?

Which is more common anagenesis or cladogenesis?

Q: Why is it beneficial for the bacterium to regulate the lac operon

Why is it beneficial for the bacterium to regulate the lac operon with both a repressor protein and an activator protein?

Q: As shown in Table 22.2, several medical agents are

As shown in Table 22.2, several medical agents are now commercially produced by genetically engineered microorganisms. Discuss the advantages and disadvantages of making these agents this way. From T...

Q: What is a mouse model for human disease?

What is a mouse model for human disease?

Q: What is a transgenic organism? Describe three examples.

What is a transgenic organism? Describe three examples.

Q: What part of the A. tumefaciens DNA gets transferred to the

What part of the A. tumefaciens DNA gets transferred to the genome of a plant cell during infection?

Q: With regard to pedigree analysis, make a list of observations that

With regard to pedigree analysis, make a list of observations that distinguish recessive, dominant, and X-linked patterns of inheritance.

Q: Hurler syndrome is due to a mutation in a gene that encodes

Hurler syndrome is due to a mutation in a gene that encodes a protein called α-l-iduronidase. This protein functions within lysosomes as an enzyme that breaks down mucopolysaccharides (a...

Q: Like Hurler syndrome, Fabry disease involves an abnormal accumulation of substances

Like Hurler syndrome, Fabry disease involves an abnormal accumulation of substances within lysosomes. However, the lysosomes of individuals with Fabry disease show an abnormal accumulation of lipids....

Q: Achondroplasia is a rare form of dwarfism caused by an autosomal dominant

Achondroplasia is a rare form of dwarfism caused by an autosomal dominant mutation that affects the gene that encodes a fibroblast growth factor receptor. Among 1,422,000 live births, the number of ba...

Q: Lesch-Nyhan syndrome is due to a mutation in a gene

Lesch-Nyhan syndrome is due to a mutation in a gene that encodes a protein called hypoxanthine-guanine phosphoribosyltransferase (HPRT). HPRT is an enzyme that functions in purine metabolism. People a...

Q: Marfan syndrome is due to a mutation in a gene that encodes

Marfan syndrome is due to a mutation in a gene that encodes a protein called fibrillin-1. It is inherited as a dominant trait. The fibrillin-1 protein is the main constituent of extracellular microfib...

Q: Which data provide the strongest evidence that O1 is not the only

Which data provide the strongest evidence that O1 is not the only operator site?

Q: Sandhoff disease is due to a mutation in a gene that encodes

Sandhoff disease is due to a mutation in a gene that encodes a protein called hexosaminidase B. This disease has symptoms that are similar to those of Tay-Sachs disease. Weakness begins in the first 6...

Q: Describe the two assumptions that underlie the identification of disease-causing

Describe the two assumptions that underlie the identification of disease-causing alleles via haplotypes.

Q: What is the purpose of the International HapMap Project? How will

What is the purpose of the International HapMap Project? How will it help researchers who study disease-causing alleles?

Q: What is a prion? Explain how a prion relies on normal

What is a prion? Explain how a prion relies on normal cellular proteins to cause a disease such as mad cow disease.

Q: Some people have a genetic predisposition for developing prion diseases. Examples

Some people have a genetic predisposition for developing prion diseases. Examples are described in Table 25.6. In the case of Gerstmann-Straüssler-Scheinker disease, the age of onset is...

Q: Explain, at the molecular level, why human genetic diseases often

Explain, at the molecular level, why human genetic diseases often follow a simple Mendelian pattern of inheritance, whereas most normal traits, such as the shape of your nose or the size of your head,...

Q: What is the difference between an oncogene and a tumor-suppressor

What is the difference between an oncogene and a tumor-suppressor gene? Give two examples of each type of gene.

Q: What is a proto-oncogene? What are the typical functions

What is a proto-oncogene? What are the typical functions of proteins encoded by proto-oncogenes? At the level of protein function, what are the general ways that proto-oncogenes can be converted to on...

Q: What is a retroviral oncogene? Is it necessary for viral infection

What is a retroviral oncogene? Is it necessary for viral infection and proliferation? How have retroviruses acquired oncogenes?

Q: A genetic predisposition to developing cancer is usually inherited as a dominant

A genetic predisposition to developing cancer is usually inherited as a dominant trait. At the level of cellular function, are the alleles involved actually dominant? Explain why some individuals who...

Q: How does tryptophan affect the function of trp repressor?

How does tryptophan affect the function of trp repressor?

Q: A genetic predisposition to developing cancer is usually inherited as a dominant

A genetic predisposition to developing cancer is usually inherited as a dominant trait. At the level of cellular function, are the alleles involved actually dominant? Explain why some individuals who...

Q: Relatively few inherited forms of cancer involve the inheritance of mutant oncogenes

Relatively few inherited forms of cancer involve the inheritance of mutant oncogenes. Instead, most inherited forms of cancer are defects in tumor-suppressor genes. Give two or more reasons why inheri...

Q: The rb gene encodes a protein that inhibits E2F, a transcription

The rb gene encodes a protein that inhibits E2F, a transcription factor that activates several genes involved in cell division. Mutations in rb are associated with certain forms of cancer, such as ret...

Q: A p53 knockout mouse in which both copies of p53 are defective

A p53 knockout mouse in which both copies of p53 are defective has been produced by researchers. This type of mouse appears normal at birth. However, it is highly sensitive to UV light. Based on your...

Q: With regard to cancer cells, which of the following statements are

With regard to cancer cells, which of the following statements are true? A. Cancer cells are clonal, which means they are derived from a single mutant cell. B. To become cancerous, cells usually acc...

Q: When the DNA of a human cell becomes damaged, the p53

When the DNA of a human cell becomes damaged, the p53 gene is activated. What is the general function of the p53 protein? Is it an enzyme, transcription factor, cell-cycle protein, or something else?...

Q: Many genetic disorders exhibit locus heterogeneity. Define and give two examples

Many genetic disorders exhibit locus heterogeneity. Define and give two examples of locus heterogeneity. How does locus heterogeneity confound a pedigree analysis?

Q: In general, why do changes in chromosome structure or number tend

In general, why do changes in chromosome structure or number tend to affect an individual’s phenotype? Explain why some changes in chromosome structure, such as reciprocal translocations, do not.

Q: We often speak of diseases such as phenylketonuria (PKU) and

We often speak of diseases such as phenylketonuria (PKU) and achondroplasia as having a genetic basis. Explain whether the following statements are accurate with regard to the genetic basis of any hum...

Q: Figure 25.1 illustrates albinism in two different species. Describe

Figure 25.1 illustrates albinism in two different species. Describe two other genetic disorders found in both humans and animals. From Figure 25.1:

Q: What type of bonding interaction causes stem-loops to form?

What type of bonding interaction causes stem-loops to form?

Q: Discuss why a genetic disease might have a particular age of onset

Discuss why a genetic disease might have a particular age of onset. Would an infectious disease have an age of onset? Explain why or why not.

Q: Gaucher disease (type I) is due to a defect in

Gaucher disease (type I) is due to a defect in a gene that encodes a protein called acid β-glucosidase. This enzyme plays a role in carbohydrate metabolism within lysosomes. The gene is located on the...

Q: Ehler-Danlos syndrome is a rare disorder caused by a mutation

Ehler-Danlos syndrome is a rare disorder caused by a mutation in a gene that encodes a protein called collagen (type 3 A1). Collagen is found in the extracellular matrix that plays an important role i...

Q: Give the meanings of the following terms: genomics, functional genomics

Give the meanings of the following terms: genomics, functional genomics, and proteomics.

Q: As described in Chapter 5, not all inherited traits are determined

As described in Chapter 5, not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, matern...

Q: Discuss some of the worthwhile traits that can be modified in transgenic

Discuss some of the worthwhile traits that can be modified in transgenic plants.

Q: Discuss the concerns that some people have with regard to the uses

Discuss the concerns that some people have with regard to the uses of genetically engineered organisms.

Q: What type of DNA structure is recognized by RecG and RuvABC?

What type of DNA structure is recognized by RecG and RuvABC? Do you think these proteins recognize DNA sequences? Be specific about what type(s) of molecular recognition these proteins can perform.

Q: Briefly describe three ways that antibody diversity is increased

Briefly describe three ways that antibody diversity is increased

Q: Describe the functions of the RAG1 and RAG2 and NHEJ proteins.

Describe the functions of the RAG1 and RAG2 and NHEJ proteins.

Q: Explain how the presence of tryptophan favors the formation of the 3

Explain how the presence of tryptophan favors the formation of the 3–4 stem-loop.

Q: According to the scenario shown in Figure 20.7, how

According to the scenario shown in Figure 20.7, how many segments of DNA (one, two, or three) are removed during site-specific recombination within the gene that encodes the κ (kappa) ligh...

Q: If you were examining a sequence of chromosomal DNA, what characteristics

If you were examining a sequence of chromosomal DNA, what characteristics would cause you to believe that the sequence contained a transposable element?

Q: For insertion elements and simple transposons, what is the function of

For insertion elements and simple transposons, what is the function of the inverted repeat sequences during transposition?

Q: Why does transposition always produce direct repeats in the chromosomal DNA?

Why does transposition always produce direct repeats in the chromosomal DNA?

Q: Discuss the reasons why the proteome is larger than the genome of

Discuss the reasons why the proteome is larger than the genome of a given species.

Q: Which types of TEs have the greatest potential for proliferation: insertion

Which types of TEs have the greatest potential for proliferation: insertion elements, simple transposons, or retrotransposons? Explain your choice

Q: Do you consider TEs to be mutagens? Explain.

Do you consider TEs to be mutagens? Explain.

Q: Let’s suppose that a species of mosquito has two different types of

Let’s suppose that a species of mosquito has two different types of simple transposons that we will call X elements and Z elements. The X elements appear quite stable. In a population of 100 mosquitoe...

Q: This chapter describes different types of TEs, including insertion elements,

This chapter describes different types of TEs, including insertion elements, simple transposons, LTR retrotransposons, and non-LTR retrotransposons. Which of these four types of TEs have the following...

Q: What features distinguish a transposon from a retrotransposon? How are their

What features distinguish a transposon from a retrotransposon? How are their sequences different, and how are their mechanisms of transposition different?

Q: How does micF antisense RNA affect the translation of ompF mRNA?

How does micF antisense RNA affect the translation of ompF mRNA?

Q: The occurrence of multiple transposons within the genome of organisms has been

The occurrence of multiple transposons within the genome of organisms has been suggested as a possible cause of chromosomal rearrangements such as deletions, translocations, and inversions. How could...

Q: What is the difference between an autonomous and a nonautonomous transposable element

What is the difference between an autonomous and a nonautonomous transposable element? Is it possible for nonautonomous TEs to move? If yes, explain how. 

Q: A segment of DNA has the following sequence: TTGGATGCTG

A segment of DNA has the following sequence: TTGGATGCTG AACCTACGAC A. What would the sequence be immediately after reaction with nitrous acid? Let the letters H represent hypoxanthine and U represent...

Q: In the treatment of cancer, the basis for many types of

In the treatment of cancer, the basis for many types of chemotherapy and radiation therapy is that mutagens are more effective at killing dividing cells than nondividing cells. Explain why. What are p...

Q: An individual carries a somatic mutation that changes a lysine codon into

An individual carries a somatic mutation that changes a lysine codon into a glutamic acid codon. Prior to acquiring this mutation, the individual had been exposed to UV light, proflavin, and 5-bromour...

Q: What is a database? What types of information are stored within

What is a database? What types of information are stored within a database? Where does the information come from? Discuss the objectives of a genome database.

Q: Which of the following examples is likely to be caused by a

Which of the following examples is likely to be caused by a somatic mutation? A. A purple flower has a small patch of white tissue. B. One child, in a family of seven, is an albino. C. One apple tr...

Q: Besides the examples listed in Table 24.3, list five

Besides the examples listed in Table 24.3, list five types of short sequences that a geneticist might want to locate within a DNA sequence.

Q: Discuss the distinction between sequence recognition and pattern recognition.

Discuss the distinction between sequence recognition and pattern recognition.

Q: A multiple-sequence alignment of five homologous proteins is shown here

A multiple-sequence alignment of five homologous proteins is shown here: Discuss some of the interesting features that this alignment reveals.

Q: Which of these mechanisms is the most energy-efficient way to

Which of these mechanisms is the most energy-efficient way to regulate gene expression? From figure 15.1:

Q: What is the difference between similarity and homology?

What is the difference between similarity and homology?

Q: When comparing (i.e., aligning) two or more

When comparing (i.e., aligning) two or more genetic sequences, it is sometimes necessary to put in gaps. Explain why. Discuss two changes (i.e., two types of mutations) that could happen during the ev...

Q: Explain the difference between gene modification and gene addition. Are the

Explain the difference between gene modification and gene addition. Are the following examples of gene modification or gene addition? A. A mouse model to study cystic fibrosis B. Introduction of a p...

Q: What four types of cellular processes must occur to enable a fertilized

What four types of cellular processes must occur to enable a fertilized egg to develop into an adult multicellular animal? Briefly discuss the role of each process.

Q: Discuss how the anterior portion of the anteroposterior axis is established in

Discuss how the anterior portion of the anteroposterior axis is established in Drosophila. What aspects of oogenesis are critical in establishing this axis? What do you think would happen if the bicoi...

Q: Describe the function of the Bicoid protein. Explain how its ability

Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a concentration-dependent manner is a critical feature of its function.

Q: With regard to development, what are the roles of the maternal

With regard to development, what are the roles of the maternal effect genes versus the zygotic genes? Which types of genes are needed earlier in the development process?

Q: Discuss the role of homeotic genes in development. Explain what happens

Discuss the role of homeotic genes in development. Explain what happens to the phenotype of a fruit fly when a gain-of-function mutation in a homeotic gene causes the protein to be expressed in an abn...

Q: Describe the molecular features of the homeobox and homeodomain. Explain how

Describe the molecular features of the homeobox and homeodomain. Explain how these features are important in the function of homeotic genes.

Q: What would you predict to be the phenotype of a Drosophila larva

What would you predict to be the phenotype of a Drosophila larva whose mother was homozygous for a loss-of-function allele in the nanos gene?

Q: Explain how an α helix in a transcription factor protein is able

Explain how an α helix in a transcription factor protein is able to function as a recognition helix.

Q: Based on the photographs in Figure 26.13, in which

Based on the photographs in Figure 26.13, in which segments is the Antp gene normally expressed? From Figure 26.13:

Q: If a mutation in a homeotic gene produced the following phenotypes,

If a mutation in a homeotic gene produced the following phenotypes, would you expect it to be a loss-of-function or a gain-of function mutation? Explain your answer. A. An abdominal segment has anten...

Q: Explain how loss-of-function mutations in the following categories

Explain how loss-of-function mutations in the following categories of genes would affect the morphologies of Drosophila larvae: A. Gap genes B. Pair-rule genes C. Segment-polarity genes

Q: What is the difference between a maternal-effect gene and a

What is the difference between a maternal-effect gene and a zygotic gene? Of the following genes that play a role in Drosophila development, which are maternal-effect genes and which are zygotic? Expl...

Q: The arrangement of body axes of the fruit fly are shown in

The arrangement of body axes of the fruit fly are shown in Figure 26.5g. Are the following statements true or false with regard to body axes in the mouse? A. Along the anterop...

Q: Cloning of mammals (such as Dolly the sheep) is described

Cloning of mammals (such as Dolly the sheep) is described in Chapter 22. Based on your understanding of animal development, explain why an enucleated egg is needed to clone mammals. In other words, wh...

Q: A hypothetical cell lineage is shown here. /

A hypothetical cell lineage is shown here. A gene, which we will call gene X, is activated in the B-1 cell, so the B-1 cell will progress through the proper developmental stages to produce three nerv...

Q: What is a heterochronic mutation? How does it affect the phenotypic

What is a heterochronic mutation? How does it affect the phenotypic outcome of an organism? What phenotypic effects would you expect if a heterochronic mutation affected the cell lineage that determin...

Q: Discuss the similarities and differences between the bithorax and Antennapedia complexes in

Discuss the similarities and differences between the bithorax and Antennapedia complexes in Drosophila and the Hox gene complexes in mice.

Q: What is cell differentiation? Discuss the role of myogenic bHLH proteins

What is cell differentiation? Discuss the role of myogenic bHLH proteins in the differentiation of muscle cells. Explain how they work at the molecular level. In your answer, explain how protein dimer...

Q: If a repressor prevents TFIID from binding to the TATA box,

If a repressor prevents TFIID from binding to the TATA box, why does this inhibit transcription?

Q: The MyoD gene in mammals plays a role in skeletal muscle-

The MyoD gene in mammals plays a role in skeletal muscle-cell differentiation, whereas the Hox genes are homeotic genes that play a role in the differentiation of particular regions of the body. Expla...

Q: What is a totipotent cell? In each of the following types

What is a totipotent cell? In each of the following types of organisms, which cells are totipotent? A. Humans B. Corn C. Yeast D. Bacteria

Q: What is a meristem? Explain the role of meristems in plant

What is a meristem? Explain the role of meristems in plant development.

Q: Discuss the morphological differences between animal and plant development. How are

Discuss the morphological differences between animal and plant development. How are the developmental processes different at the cellular level? How are they similar at the genetic level?

Q: If you observed fruit flies with the following developmental abnormalities, would

If you observed fruit flies with the following developmental abnormalities, would you guess that a mutation has occurred in a segmentation gene or a homeotic gene? Explain your guess. A. Three abdomi...

Q: Which of the following statement(s) is/are true

Which of the following statement(s) is/are true with regard to positional information in Drosophila? A. Morphogens are a type of molecule that conveys positional information. B. Morphogenetic gradie...

Q: Discuss the morphological differences between the parasegments and segments of Drosophila.

Discuss the morphological differences between the parasegments and segments of Drosophila. Discuss the evidence, providing specific examples, that suggests the parasegments of the embryo are the subdi...

Q: Here are schematic diagrams of mutant Drosophila larvae. /

Here are schematic diagrams of mutant Drosophila larvae. The left side of each pair shows a wild-type larva, with gray boxes showing the sections that are missing in the mutant larva. Which type of g...

Q: Explain what a morphogen is, and describe how it exerts its

Explain what a morphogen is, and describe how it exerts its effects. What do you expect will happen when a morphogen is expressed in the wrong place in an embryo? List five examples of morphogens that...

Q: What is positional information? Discuss three different ways that cells obtain

What is positional information? Discuss three different ways that cells obtain positional information. Which of these three ways do you think is the most important for the formation of a segmented bod...

Q: When an activator protein interacts with mediator, how does this affect

When an activator protein interacts with mediator, how does this affect the function of RNA polymerase?

Q: Gradients of morphogens can be preestablished in the oocyte. Also,

Gradients of morphogens can be preestablished in the oocyte. Also, later in development, morphogens can be secreted from cells. How are these two processes similar and different?

Q: What is the gene pool? How is a gene pool described

What is the gene pool? How is a gene pool described in a quantitative way?

Q: What evolutionary factors can cause allele frequencies to change and possibly lead

What evolutionary factors can cause allele frequencies to change and possibly lead to a genetic polymorphism? Discuss the relative importance of each type of process.

Q: What is the difference between a neutral and an adaptive evolutionary process

What is the difference between a neutral and an adaptive evolutionary process? Describe two or more examples of each. At the molecular level, explain how mutations can be neutral or adaptive.

Q: What is Darwinian fitness? What types of characteristics can promote high

What is Darwinian fitness? What types of characteristics can promote high fitness values? Give several examples.

Q: What is the intuitive meaning of the mean fitness of a population

What is the intuitive meaning of the mean fitness of a population? How does its value change in response to natural selection?

Q: Describe the similarities and differences among directional, balancing, disruptive,

Describe the similarities and differences among directional, balancing, disruptive, and stabilizing selection.

Q: Is each of the following examples due to directional, disruptive,

Is each of the following examples due to directional, disruptive, balancing, or stabilizing selection? A. Polymorphisms in snail color and banding pattern as described in Figure 27.12 B. Thick fur a...

Q: For the term genetic drift, what is drifting? Why is

For the term genetic drift, what is drifting? Why is this an appropriate term to describe this phenomenon?

Q: Why is genetic drift more significant in small populations? Why does

Why is genetic drift more significant in small populations? Why does it take longer for genetic drift to cause allele fixation in large populations than in small ones?

Q: Why is G. tetrahit reproductively isolated from the other two species

Why is G. tetrahit reproductively isolated from the other two species?

Q: Explain why the glucocorticoid receptor binds next to the core promoter of

Explain why the glucocorticoid receptor binds next to the core promoter of some genes, but not next to the core promoter of most genes.

Q: A group of four birds flies to a new location and initiates

A group of four birds flies to a new location and initiates a new colony. Three of the birds are homozygous AA, and one bird is heterozygous Aa. A. What is the probability that the a allele will beco...

Q: Describe what happens to allele frequencies as a result of the bottleneck

Describe what happens to allele frequencies as a result of the bottleneck effect. Discuss the relevance of this effect with regard to species that are approaching extinction.

Q: In genetics, what does the term population mean? Pick any

In genetics, what does the term population mean? Pick any species you like and describe how its population might change over the course of many generations.

Q: With regard to genetic drift, are the following statements true or

With regard to genetic drift, are the following statements true or false? If a statement is false, explain why. A. Over the long run, genetic drift leads to allele fixation or loss. B. When a new mu...

Q: When two populations frequently intermix due to migration, what are the

When two populations frequently intermix due to migration, what are the long-term consequences with regard to allele frequencies and genetic variation?

Q: Two populations of antelope are separated by a mountain range. The

Two populations of antelope are separated by a mountain range. The antelope are known to occasionally migrate from one population to the other. Migration can occur in either direction. Explain how mig...

Q: Does inbreeding affect allele frequencies? Why or why not? How

Does inbreeding affect allele frequencies? Why or why not? How does it affect genotype frequencies? With regard to rare recessive diseases, what are the consequences of inbreeding in human populations...

Q: What is genetic polymorphism? What is the source of genetic variation

What is genetic polymorphism? What is the source of genetic variation?

Q: Identify each of the following as an example of allele, genotype

Identify each of the following as an example of allele, genotype, and/or phenotype frequency: A. Approximately 1 in 2500 people of Northern European descent is born with cystic fibrosis. B. The perc...

Q: The term polymorphism can refer to both genes and traits. Explain

The term polymorphism can refer to both genes and traits. Explain what is meant by a polymorphic gene and a polymorphic trait. If a gene is polymorphic, does the trait that the gene affects also have...

Q: How might nucleosome eviction affect transcription?

How might nucleosome eviction affect transcription?

Q: Cystic fibrosis (CF) is a recessive autosomal disorder. In

Cystic fibrosis (CF) is a recessive autosomal disorder. In certain populations of Northern European descent, the number of people born with this disorder is about 1 in 2500. Assuming HardyWeinberg equ...

Q: For a gene existing in two alleles, what are the allele

For a gene existing in two alleles, what are the allele frequencies when the heterozygote frequency is at its maximum value, assuming Hardy-Weinberg equilibrium? What if there are three alleles?

Q: In a population, the frequencies of two alleles are B =

In a population, the frequencies of two alleles are B = 0.67 and b = 0.33. The genotype frequencies are BB = 0.50, Bb = 0.37, and bb = 0.13. Do these numbers suggest inbreeding? Explain why or why not...

Q: The ability to roll your tongue is inherited as a recessive trait

The ability to roll your tongue is inherited as a recessive trait. The frequency of the rolling allele is approximately 0.6, and that of the dominant (nonrolling) allele is 0.4. What is the frequency...

Q: Give several examples of quantitative traits. How are these quantitative traits

Give several examples of quantitative traits. How are these quantitative traits described within groups of individuals?

Q: When a correlation coefficient is statistically significant, what do you conclude

When a correlation coefficient is statistically significant, what do you conclude about the two variables? What do the results mean with regard to cause and effect?

Q: What is polygenic inheritance? Discuss the issues that make polygenic inheritance

What is polygenic inheritance? Discuss the issues that make polygenic inheritance difficult to study.

Q: What is a quantitative trait locus (QTL)? Does a QTL

What is a quantitative trait locus (QTL)? Does a QTL contain one gene or multiple genes? What technique is commonly used to identify QTLs?

Q: Let’s suppose that weight in a species of mammal is polygenic,

Let’s suppose that weight in a species of mammal is polygenic, and each gene exists as a heavy and light allele. If the allele frequencies in the population are equal for both types of alleles (i.e.,...

Q: The broad-sense heritability for a trait equals 1.0

The broad-sense heritability for a trait equals 1.0. In your own words, explain what this value means. Would you conclude that the environment is unimportant in the outcome of this trait? Explain your...

Q: Explain how DNA methylation could be transmitted by a cis-epigenetic

Explain how DNA methylation could be transmitted by a cis-epigenetic mechanism.

Q: From an agricultural point of view, discuss the advantages and disadvantages

From an agricultural point of view, discuss the advantages and disadvantages of selective breeding. It is common for plant breeders to take two different, highly inbred strains, which are the product...

Q: Many beautiful varieties of roses have been produced, particularly in the

Many beautiful varieties of roses have been produced, particularly in the last few decades. These newer varieties often have very striking and showy flowers, making them desirable as horticultural spe...

Q: In your own words, explain the meaning of the term heritability

In your own words, explain the meaning of the term heritability. Why is a heritability value valid only for a particular population of individuals raised in a particular environment?

Q: What is the difference between broad-sense heritability and narrow-

What is the difference between broad-sense heritability and narrow-sense heritability? Why is narrow-sense heritability such a useful concept in the field of agricultural genetics?

Q: The heritability for egg weight in a group of chickens on a

The heritability for egg weight in a group of chickens on a farm in Maine is 0.95. Are the following statements regarding this heritability true or false? If a statement is false, explain why. A. The...

Q: At the molecular level, explain why quantitative traits often exhibit a

At the molecular level, explain why quantitative traits often exhibit a continuum of phenotypes within a population. How does the environment help produce this continuum?

Q: In a fairly large population of people living in a commune in

In a fairly large population of people living in a commune in the southern United States, everyone cares about good nutrition. All of the members of this population eat very nutritious foods, and thei...

Q: When artificial selection is practiced over many generations, it is common

When artificial selection is practiced over many generations, it is common for the trait to reach a plateau in which further selection has little effect on the outcome of the trait. This phenomenon is...

Q: Discuss whether a natural population of wolves or a domesticated population of

Discuss whether a natural population of wolves or a domesticated population of German shepherds is more likely to have a higher heritability for the trait of size.

Q: What is a normal distribution? Discuss this curve with regard to

What is a normal distribution? Discuss this curve with regard to quantitative traits within a population. What is the relationship between the standard deviation and the normal distribution?

Q: Which of these patterns applies to the imprinting of the Igf2 gene

Which of these patterns applies to the imprinting of the Igf2 gene, described in Chapter 5? From figure 16.3:

Q: Explain the difference between a continuous trait and a discontinuous trait.

Explain the difference between a continuous trait and a discontinuous trait. Give two examples of each. Are quantitative traits likely to be continuous or discontinuous? Explain why.

Q: What is a frequency distribution? Explain how such a graph is

What is a frequency distribution? Explain how such a graph is made for a quantitative trait that is continuous.

Q: The variance for weight in a particular herd of cattle is 484

The variance for weight in a particular herd of cattle is 484 pounds2 . The mean weight is 562 pounds. How heavy would an animal have to be if it was in the top 2.5% of the herd? The bottom 0.13%?

Q: Two different varieties of potato plants produce potatoes with the same mean

Two different varieties of potato plants produce potatoes with the same mean weight of 1.5 pounds. One variety has a very low variance for potato weight, and the other has a much higher variance. A....

Q: If r = 0.5 and N = 4, would

If r = 0.5 and N = 4, would you conclude that a positive correlation exists between the two variables? Explain your answer. What if N = 500?

Q: What does it mean when a correlation coefficient is negative? Can

What does it mean when a correlation coefficient is negative? Can you think of examples?

Q: Discuss the two principles on which evolution is based.

Discuss the two principles on which evolution is based.

Q: Evolution, which involves genetic changes in a population of organisms over

Evolution, which involves genetic changes in a population of organisms over time, is often described as the unifying theme in biology. Discuss how evolution is unifying at the molecular and cellular l...

Q: What is a species? What types of observations do researchers analyze

What is a species? What types of observations do researchers analyze when trying to identify species?

Q: What is meant by the term reproductive isolation? Give several examples

What is meant by the term reproductive isolation? Give several examples.

Q: In X-chromosome inactivation, when is the choice made as

In X-chromosome inactivation, when is the choice made as to which X chromosome is inactivated? Does this choice occur in embryonic cells, in adult somatic cells, or both?

Q: Would each of the following examples of reproductive isolation be considered a

Would each of the following examples of reproductive isolation be considered a prezygotic or postzygotic mechanism? A. Horses and donkeys can interbreed to produce mules, but the mules are infertile....

Q: Distinguish between anagenesis and cladogenesis. Which mechanism of speciation is more

Distinguish between anagenesis and cladogenesis. Which mechanism of speciation is more prevalent? Why?

Q: Describe three or more genetic mechanisms that may lead to the rapid

Describe three or more genetic mechanisms that may lead to the rapid evolution of a new species. Which of these genetic mechanisms are influenced by natural selection, and which are not?

Q: Explain the type of speciation (allopatric, parapatric, or sympatric

Explain the type of speciation (allopatric, parapatric, or sympatric) most likely to occur under each of the following conditions: A. A pregnant female rat is transported by an ocean liner to a new c...

Q: Alloploids are produced by crosses involving two different species. Explain why

Alloploids are produced by crosses involving two different species. Explain why alloploids may be reproductively isolated from the two original species from which they were derived. Explain why allopl...

Q: Discuss whether the phenomenon of reproductive isolation applies to bacteria, which

Discuss whether the phenomenon of reproductive isolation applies to bacteria, which reproduce asexually. How would a geneticist divide bacteria into separate species?

Q: Discuss the major differences among allopatric, parapatric, and sympatric speciation

Discuss the major differences among allopatric, parapatric, and sympatric speciation.

Q: The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA

The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do n...

Q: What is meant by the term molecular clock? How is this

What is meant by the term molecular clock? How is this concept related to the neutral theory of evolution?

Q: Would the rate of deleterious or beneficial mutations be a good molecular

Would the rate of deleterious or beneficial mutations be a good molecular clock? Why or why not?

Q: Describe how the compaction of nucleosomes into a knot-like structure

Describe how the compaction of nucleosomes into a knot-like structure could silence gene expression.

Q: Which would you expect to exhibit a faster rate of evolutionary change

Which would you expect to exhibit a faster rate of evolutionary change, the nucleotide sequence of a gene or the amino acid sequence of the encoded polypeptide of the same gene? Explain your answer.

Q: When comparing the coding regions of a protein-encoding gene among

When comparing the coding regions of a protein-encoding gene among closely related species, certain regions are commonly found to have evolved more rapidly (i.e., have tolerated more changes in sequen...

Q: Plant seeds contain storage proteins that are encoded by the plant’s genes

Plant seeds contain storage proteins that are encoded by the plant’s genes. When a seed germinates, these proteins are rapidly hydrolyzed (i.e., the covalent bonds between amino acids within the polyp...

Q: Take a look at the α-globin and β-globin

Take a look at the α-globin and β-globin amino acid sequences in Figure 29.11. Which sequences are more similar, the α globin in humans and the α...

Q: Compare and contrast the neutral theory of evolution and the Darwinian (

Compare and contrast the neutral theory of evolution and the Darwinian (i.e., selectionist) theory of evolution. Explain why the neutral theory of evolution is sometimes called non-Darwinian evolution...

Q: For each of the following examples, discuss whether the observed result

For each of the following examples, discuss whether the observed result is due to neutral mutations or mutations that have been acted on by natural selection, or both: A. When comparing sequences of...

Q: As discussed in Chapter 27, genetic variation is prevalent in natural

As discussed in Chapter 27, genetic variation is prevalent in natural populations. This variation is revealed in the DNA sequencing of genes. Based on the neutral theory of evolution, discuss the rela...

Q: If you were comparing the karyotypes of species that are closely related

If you were comparing the karyotypes of species that are closely related evolutionarily, what types of similarities and differences would you expect to find?

Q: With regard to heterosis, is each of the following statements consistent

With regard to heterosis, is each of the following statements consistent with the dominance hypothesis, the overdominance hypothesis, or both? A. Strains that have been highly inbred have become mono...

Q: Using the pedigree shown here, answer the following questions for individual

Using the pedigree shown here, answer the following questions for individual VI-1. A. Is this individual inbred? B. If so, who is/are her parents’ common ancestor(s)? C. Calculate...

Q: In the F1 offspring, what happened to the B-I

In the F1 offspring, what happened to the B-I allele that was inherited from the parent at the top right?

Q: A family pedigree is shown here. / A

A family pedigree is shown here. A. What is the inbreeding coefficient for individual IV-3? B. Based on the data shown in this pedigree, is individual IV-4 inbred?

Q: A family pedigree is shown here. / A

A family pedigree is shown here. A. What is the inbreeding coefficient for individual IV-2? Who is/ are her parents’ common ancestor(s)? B. Based on the data shown in this pedigree...

Q: Antibiotics are commonly used to combat bacterial and fungal infections. During

Antibiotics are commonly used to combat bacterial and fungal infections. During the past several decades, however, antibioticresistant strains of microorganisms have become alarmingly prevalent. This...

Q: Let’s suppose the mutation rate for converting a B allele into a

Let’s suppose the mutation rate for converting a B allele into a b allele is 10–4. The current allele frequencies are B = 0.6 and b = 0.4. How long will it take for the allele frequencies to equal eac...

Q: Predict the phenotypic consequences of each of the following mutations:

Predict the phenotypic consequences of each of the following mutations: A. apetala1 defective B. pistillata defective C. apetala1 and pistillata defective

Q: Explain how alternative splicing affects sex determination in Drosophila.

Explain how alternative splicing affects sex determination in Drosophila.

Q: How would nucleotide excision repair be affected if one of the following

How would nucleotide excision repair be affected if one of the following proteins was missing? Describe the condition of the DNA if the repair was attempted in the absence of the protein. A. UvrA B....

Q: During mismatch repair, why is it necessary to distinguish between the

During mismatch repair, why is it necessary to distinguish between the template strand and the newly made daughter strand? How is this accomplished?

Q: What are the two main mechanisms by which cells repair doublestrand breaks

What are the two main mechanisms by which cells repair doublestrand breaks? Briefly describe each one.

Q: With regard to the repair of double-strand breaks, what

With regard to the repair of double-strand breaks, what are the advantages and disadvantages of homologous recombination repair versus nonhomologous end joining?

Q: Are queen and worker bees genetically different from each other?

Are queen and worker bees genetically different from each other?

Q: When DNA N-glycosylase recognizes a thymine dimer, it detects

When DNA N-glycosylase recognizes a thymine dimer, it detects only the thymine located on the 5′ side of the dimer as being abnormal. Make a drawing and explain the steps whereby a thymine dimer is re...

Q: What is the underlying genetic defect that causes xeroderma pigmentosum? How

What is the underlying genetic defect that causes xeroderma pigmentosum? How can the symptoms of this disease be explained by the genetic defect?

Q: Three common ways to repair changes in DNA structure are nucleotide excision

Three common ways to repair changes in DNA structure are nucleotide excision repair, mismatch repair, and homologous recombination repair. Which of these three mechanisms would be used to fix the foll...

Q: Discuss the similarities and differences between nucleotide excision repair and the mismatch

Discuss the similarities and differences between nucleotide excision repair and the mismatch repair system.

Q: In E. coli, a methyltransferase enzyme encoded by the dam

In E. coli, a methyltransferase enzyme encoded by the dam gene recognizes the sequence 5′–GATC–3′ and attaches a methyl group to the nitrogen at position 6 of adenine. E. coli strains that have the da...

Q: A species of bacteria can synthesize the amino acid histidine, so

A species of bacteria can synthesize the amino acid histidine, so they do not require histidine in their growth medium. A key enzyme, which we will call histidine synthetase, is necessary for histidin...

Q: Using three examples, describe how allosteric sites are important in the

Using three examples, describe how allosteric sites are important in the function of genetic regulatory proteins.

Q: How are the actions of lac repressor and trp repressor similar and

How are the actions of lac repressor and trp repressor similar and how are they different with regard to their binding to operator sites, their effects on transcription, and the influences of small ef...

Q: Transcriptional repressor proteins (e.g., lac repressor), antisense

Transcriptional repressor proteins (e.g., lac repressor), antisense RNA, and feedback inhibition are three different mechanisms that turn off the expression of genes and gene products. Which of these...

Q: If a gene is repressible and under positive control, what kind

If a gene is repressible and under positive control, what kind of effector molecule and regulatory protein are involved in its regulation? Explain how the binding of the effector molecule affects the...

Q: What types of molecules can bind to a non-coding RNA

What types of molecules can bind to a non-coding RNA?

Q: Transcriptional regulation often involves a regulatory protein that binds to a segment

Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a small effector molecule that binds to the regulatory protein. Do each of the following terms apply t...

Q: An operon is repressible—a small effector molecule turns off its

An operon is repressible—a small effector molecule turns off its transcription. Which combination(s) of small effector molecule and regulatory protein could be involved in this process? A. An inducer...

Q: Some mutations have a cis-effect, whereas others have a

Some mutations have a cis-effect, whereas others have a transeffect. Explain the molecular differences between cis- and transmutations. Which type of mutation (cis or trans) can be complemented in a m...

Q: What is enzyme adaptation? From a genetic point of view,

What is enzyme adaptation? From a genetic point of view, how does it occur?

Q: In the lac operon, how would gene expression be affected if

In the lac operon, how would gene expression be affected if each one of the following segments was missing? A. lac operon promoter B. Operator site C. lacA gene

Q: If an abnormal repressor protein could still bind allolactose but the binding

If an abnormal repressor protein could still bind allolactose but the binding of allolactose did not alter the conformation of the repressor protein, how would the expression of the lac operon be affe...

Q: Discuss the common points of control in eukaryotic gene regulation.

Discuss the common points of control in eukaryotic gene regulation.

Q: Explain how phosphorylation affects the function of the CREB protein.

Explain how phosphorylation affects the function of the CREB protein.

Q: A particular drug inhibits the protein kinase that is responsible for phosphorylating

A particular drug inhibits the protein kinase that is responsible for phosphorylating the CREB protein. How would this drug affect the following events? A. The ability of the CREB protein to bind to...

Q: The glucocorticoid receptor and the CREB protein are two examples of transcriptional

The glucocorticoid receptor and the CREB protein are two examples of transcriptional activators. These proteins bind to response elements and activate transcription. (Note: The answers to this questio...

Q: Explain why RISC binds to a specific mRNA. What type of

Explain why RISC binds to a specific mRNA. What type of bonding occurs?

Q: Transcription factors such as the glucocorticoid receptor and the CREB protein form

Transcription factors such as the glucocorticoid receptor and the CREB protein form homodimers and activate transcription. Other transcription factors form heterodimers. For example, a transcription f...

Q: An enhancer, located upstream from a gene, has the following

An enhancer, located upstream from a gene, has the following sequence: 5′–GTAG–3′ 3′–CATC–5′ This enhancer is orientation-independent. Which of the following sequences also works as an enhancer? A....

Q: The DNA-binding domain of each CREB protein subunit recognizes the

The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains...

Q: The gene that encodes the enzyme called tyrosine hydroxylase is known to

The gene that encodes the enzyme called tyrosine hydroxylase is known to be activated by the CREB protein. Tyrosine hydroxylase is expressed in nerve cells and is involved in the synthesis of catechol...

Q: Briefly describe three ways that ATP-dependent chromatin-remodeling complexes

Briefly describe three ways that ATP-dependent chromatin-remodeling complexes may change chromatin structure.

Q: Discuss the structure and function of regulatory elements. Where are they

Discuss the structure and function of regulatory elements. Where are they located relative to the core promoter?

Q: What is meant by the term transcription factor modulation? List three

What is meant by the term transcription factor modulation? List three general ways this can occur.

Q: What are the functions of transcriptional activator proteins and repressor proteins?

What are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.

Q: Is each of the following statements true or false? A

Is each of the following statements true or false? A. An enhancer is a type of regulatory element. B. A core promoter is a type of regulatory element. C. Regulatory transcription factors bind to re...

Q: Transcription factors usually contain one or more motifs that play key roles

Transcription factors usually contain one or more motifs that play key roles in their function. What is the function of the following motifs? A. Helix-turn-helix B. Zinc finger C. Leucine zipper

Q: What is a clade?

What is a clade?

Q: Which type of snoRNA causes an rRNA to be methylated?

Which type of snoRNA causes an rRNA to be methylated?

Q: The binding of a small effector molecule, protein-protein interactions

The binding of a small effector molecule, protein-protein interactions, and covalent modifications are three common ways to modulate the activities of transcription factors. Which of these three mecha...

Q: Describe the steps that need to occur for the glucocorticoid receptor to

Describe the steps that need to occur for the glucocorticoid receptor to bind to a GRE.

Q: Let’s suppose a mutation in the glucocorticoid receptor does not prevent the

Let’s suppose a mutation in the glucocorticoid receptor does not prevent the binding of the glucocorticoid hormone to the protein but prevents the ability of the receptor to activate transcription. Ma...

Q: Define epigenetics. Are all epigenetic changes passed from parent to offspring

Define epigenetics. Are all epigenetic changes passed from parent to offspring? Explain.

Q: What are the contrasting roles of trithorax and polycomb group complexes during

What are the contrasting roles of trithorax and polycomb group complexes during development in animals and plants?

Q: Describe the molecular steps by which polycomb group complexes cause epigenetic gene

Describe the molecular steps by which polycomb group complexes cause epigenetic gene silencing.

Q: With regard to development, what would the dire consequences be if

With regard to development, what would the dire consequences be if polycomb group complexes did not function properly?

Q: Using coat color in mice and the development of female honeybees as

Using coat color in mice and the development of female honeybees as examples, explain how dietary factors can cause epigenetic modifications, leading to phenotypic effects.

Q: How can environmental agents that do not cause gene mutations contribute to

How can environmental agents that do not cause gene mutations contribute to cancer? Would these epigenetic changes be passed to offspring?

Q: Is paramutation a cis- or a trans-epigenetic mechanism?

Is paramutation a cis- or a trans-epigenetic mechanism?

Q: Why is GTP necessary for this process?

Why is GTP necessary for this process?

Q: If a winter-annual strain of Arabidopsis is grown in a

If a winter-annual strain of Arabidopsis is grown in a greenhouse and not exposed to cold temperatures, its ability to flower is inhibited. Which gene is responsible for this inhibition?

Q: List and briefly describe five types of molecular mechanisms that may underlie

List and briefly describe five types of molecular mechanisms that may underlie epigenetic gene regulation.

Q: Explain how epigenetic changes may be targeted to specific genes.

Explain how epigenetic changes may be targeted to specific genes.

Q: What is the key difference between cis- and trans-epigenetic

What is the key difference between cis- and trans-epigenetic mechanisms for maintaining an epigenetic modification? In Chapter 5, we considered genomic imprinting of the Igf2 gene, in which offspring...

Q: Explain how DNA methylation and the formation of a DNA loop control

Explain how DNA methylation and the formation of a DNA loop control the expression of the Igf2 gene in mammals. How is this gene imprinted so that only the paternal copy is expressed in offspring?

Q: Let’s suppose a mutation removes the ICR next to the Igf2 gene

Let’s suppose a mutation removes the ICR next to the Igf2 gene. If this mutation is inherited from the mother, will the Igf2 gene (from the mother) be silenced or expressed? Explain.

Q: Outline the molecular steps in the process of X-chromosome inactivation

Outline the molecular steps in the process of X-chromosome inactivation (XCI). Which step plays a key role in choosing which of the X chromosomes will remain active and which will be inactivated?

Q: Following X-chromosome inactivation, most of the genes on the

Following X-chromosome inactivation, most of the genes on the inactivated X chromosome are silenced. Explain how. Name one gene that is not silenced.

Q: In general, explain how epigenetic modifications are an important mechanism for

In general, explain how epigenetic modifications are an important mechanism for developmental changes that lead to specialized body parts and cell types. How do the trithorax and polycomb group comple...

Q: List and briefly describe four types of molecules that can bind to

List and briefly describe four types of molecules that can bind to an ncRNA.

Q: Which component of the CRISPR-Cas system directly recognizes the bacteriophage

Which component of the CRISPR-Cas system directly recognizes the bacteriophage DNA?

Q: Look at Figure 17.6 and predict what would happen if

Look at Figure 17.6 and predict what would happen if the SRP RNA was unable to stimulate the GTPase activities of the GTPbinding proteins within SRP and the SRP receptor. From Figure 17.6:

Q: Compare and contrast the roles of crRNA and tracrRNA in the defense

Compare and contrast the roles of crRNA and tracrRNA in the defense process against bacteriophages provided by the CRISPRCas system.

Q: In the CRISPR-Cas system, does the tracrRNA act as

In the CRISPR-Cas system, does the tracrRNA act as a scaffold, guide, ribozyme, blocker, decoy, and/or alterer of protein function or stability?

Q: What are the roles of Cas1, Cas2, and Cas9 proteins

What are the roles of Cas1, Cas2, and Cas9 proteins in bacterial genome defense?

Q: Outline the steps that occur when piRISCs silence transposable elements by repressing

Outline the steps that occur when piRISCs silence transposable elements by repressing transcription and by directly inhibiting TE RNAs. What is the role of piRNAs in this process?

Q: List five types of cancer in which ncRNAs can be involved.

List five types of cancer in which ncRNAs can be involved.

Q: Explain how the miR-200 family of miRNAs behave as tumorsuppressor

Explain how the miR-200 family of miRNAs behave as tumorsuppressor genes. What happens when their expression is blocked or decreased?

Q: Explain how the VIN3/PRC2 complex specifically binds to the FLC

Explain how the VIN3/PRC2 complex specifically binds to the FLC gene.  

Q: What is a histone variant?

What is a histone variant?

Q: Explain how the acetylation of core histones may loosen chromatin packing.

Explain how the acetylation of core histones may loosen chromatin packing.

Q: What are the two ways in which piRNAs and PIWI proteins prevent

What are the two ways in which piRNAs and PIWI proteins prevent the movement of transposable elements?

Q: An ncRNA may have the following functions: scaffold, guide,

An ncRNA may have the following functions: scaffold, guide, alterer of protein function or stability, ribozyme, blocker, and/or decoy. Which of those functions is/are mediated by each of the ncRNAs li...

Q: What is meant by the term histone code? With regard to

What is meant by the term histone code? With regard to gene regulation, what is the proposed role of the histone code?

Q: What is a nucleosome-free region? Where are such regions

What is a nucleosome-free region? Where are such regions typically found in a genome? How are nucleosome-free regions thought to be functionally important?

Q: Histones are thought to be displaced as RNA polymerase is transcribing a

Histones are thought to be displaced as RNA polymerase is transcribing a gene. What would be the potentially harmful consequences if histones were not put back onto a gene after RNA polymerase had pas...

Q: What is an insulator? Describe two different ways that insulators may

What is an insulator? Describe two different ways that insulators may exert their effects.

Q: What is DNA methylation? When we say that DNA methylation is

What is DNA methylation? When we say that DNA methylation is heritable, what do we mean? How is it passed from a mother to a daughter cell?

Q: Let’s suppose that a vertebrate organism carries a mutation that causes some

Let’s suppose that a vertebrate organism carries a mutation that causes some cells that normally differentiate into nerve cells to differentiate into muscle cells. A molecular analysis reveals that th...

Q: What is a CpG island? Where would you expect one to

What is a CpG island? Where would you expect one to be located? How does the methylation of CpG islands affect gene expression?

Q: Describe how the binding of iron regulatory protein to an IRE affects

Describe how the binding of iron regulatory protein to an IRE affects the mRNAs for ferritin and the transferrin receptor. How does iron (Fe3+) influence this process?

Q: What is meant by the term RNA world? Describe observations and

What is meant by the term RNA world? Describe observations and evidence that support this hypothesized period of life on Earth. From the perspective of living cells, what are the advantages of having...

Q: Describe two different ways that histone modifications may alter chromatin structure.

Describe two different ways that histone modifications may alter chromatin structure.

Q: Explain how HOTAIR plays a role in the transcriptional regulation of particular

Explain how HOTAIR plays a role in the transcriptional regulation of particular genes. 

Q: What is the phenomenon of RNA interference (RNAi)? During RNAi

What is the phenomenon of RNA interference (RNAi)? During RNAi, explain how the double-stranded RNA is processed and how it leads to the silencing of a complementary mRNA.

Q: With regard to RNAi, what are three possible sources for doublestranded

With regard to RNAi, what are three possible sources for doublestranded RNA?

Q: What is the difference between an miRNA and an siRNA. How

What is the difference between an miRNA and an siRNA. How do these ncRNAs affect mRNAs?

Q: Together with a specific set of proteins, snoRNAs direct the methylation

Together with a specific set of proteins, snoRNAs direct the methylation or pseudouridylation of rRNAs. Does the snoRNA function as a scaffold, guide, ribozyme, blocker, decoy, and/or alterer of prote...

Q: Describe the structure of SRP in eukaryotes, and outline its role

Describe the structure of SRP in eukaryotes, and outline its role in targeting proteins to the ER membrane.

Q: Discuss why viruses are considered nonliving.

Discuss why viruses are considered nonliving.

Q: What is the difference between a temperate phage versus a virulent phage

What is the difference between a temperate phage versus a virulent phage?

Q: What is a prophage, a provirus, and an episome?

What is a prophage, a provirus, and an episome? What is their common role in a viral reproductive cycle?

Q: What key features distinguish the lytic from the lysogenic cycle?

What key features distinguish the lytic from the lysogenic cycle?

Q: Why is an NFR needed at the core promoter for transcription to

Why is an NFR needed at the core promoter for transcription to occur?

Q: Describe the role that integrase plays during the insertion of λ DNA

Describe the role that integrase plays during the insertion of λ DNA into the host chromosome.

Q: With regard to promoting the lytic or lysogenic cycle, what would

With regard to promoting the lytic or lysogenic cycle, what would happen if the following genes were missing from the λ genome? A. cro B. cI C. cII D. int E. cII and cro

Q: How do the λ repressor and the cro protein affect the transcription

How do the λ repressor and the cro protein affect the transcription from PR and PRM? Explain where these proteins are binding to cause their effects.

Q: In your own words, explain why it is necessary for the

In your own words, explain why it is necessary for the cI gene to have two promoters. What would happen if it had only PRE?

Q: Figure 18.11 shows a genetic switch that controls the choice

Figure 18.11 shows a genetic switch that controls the choice between the lytic and lysogenic cycles of phage λ. What is a genetic switch? Compare the roles of a genetic switch...

Q: Describe the process of reverse transcription of HIV RNA.

Describe the process of reverse transcription of HIV RNA.

Q: Why is a host-cell tRNA needed for reverse transcription?

Why is a host-cell tRNA needed for reverse transcription?

Q: What structural features are common to all viruses? Which features are

What structural features are common to all viruses? Which features are found only in certain types of viruses?

Q: Explain the role of RNase H (a component of reverse transcriptase

Explain the role of RNase H (a component of reverse transcriptase) during the synthesis of HIV DNA.

Q: Describe how HIV DNA is integrated into a chromosome of the host

Describe how HIV DNA is integrated into a chromosome of the host cell.

Q: Explain why histone eviction is needed for the elongation phase of transcription

Explain why histone eviction is needed for the elongation phase of transcription.

Q: What is the role of the Vpr protein during the process of

What is the role of the Vpr protein during the process of HIV DNA integration?

Q: Why is gap repair synthesis needed during HIV DNA integration?

Why is gap repair synthesis needed during HIV DNA integration?

Q: Compare and contrast the roles of fully spliced, incompletely spliced,

Compare and contrast the roles of fully spliced, incompletely spliced, and unspliced HIV RNA. Which type is needed in the early stages of HIV proliferation, and which is needed in later stages?

Q: Describe the role of the Gag polyprotein during the assembly of HIV

Describe the role of the Gag polyprotein during the assembly of HIV components at the host-cell plasma membrane.

Q: How does an HIV particle acquire its envelope?

How does an HIV particle acquire its envelope?

Q: Explain the role of HIV protease during the process of HIV maturation

Explain the role of HIV protease during the process of HIV maturation.

Q: What is the difference between a constitutive gene and a regulated gene

What is the difference between a constitutive gene and a regulated gene?

Q: What is diauxic growth? Explain the roles of cAMP and CAP

What is diauxic growth? Explain the roles of cAMP and CAP in this process.

Q: What are the similarities and differences among viral genomes?

What are the similarities and differences among viral genomes?

Q: Mutations may have an effect on the expression of the lac operon

Mutations may have an effect on the expression of the lac operon and the trp operon. Would the following mutations have a cis- or transeffect on the expression of the protein-encoding genes in the ope...

Q: What features vary among different types of viruses?

What features vary among different types of viruses?

Q: Would a mutation that inactivated lac repressor and prevented it from binding

Would a mutation that inactivated lac repressor and prevented it from binding to the lac operator site result in the constitutive expression of the lac operon under all conditions? Explain. What is th...

Q: What is meant by the term attenuation? Is it an example

What is meant by the term attenuation? Is it an example of gene regulation at the level of transcription or translation? Explain your answer.

Q: As shown in Figure 14.12, four regions within the

As shown in Figure 14.12, four regions within the trpL mRNA can form stem-loops. Let’s suppose that mutations have been previously identified that prevent the ability of a particular...

Q: As described in Chapter 13, enzymes known as aminoacyl-tRNA

As described in Chapter 13, enzymes known as aminoacyl-tRNA synthetases are responsible for attaching amino acids to tRNAs. Let’s suppose that in a mutant bacterium tryptophanyl-tRNA synthetase has a...

Q: The combination of a 3–4 stem-loop and a

The combination of a 3–4 stem-loop and a U-rich attenuator in the trp operon (see Figure 14.12) is an example of a ρ-independent terminator. The function of &I...

Q: Mutations in tRNA genes can create tRNAs that recognize stop codons.

Mutations in tRNA genes can create tRNAs that recognize stop codons. Because stop codons are sometimes called nonsense codons, these types of mutations that affect tRNAs are called nonsense suppressor...

Q: Translational control is usually aimed at preventing the initiation of translation.

Translational control is usually aimed at preventing the initiation of translation. With regard to cellular efficiency, why do you think this is the case?

Q: What is antisense RNA? How does it affect the translation of

What is antisense RNA? How does it affect the translation of a complementary mRNA?

Q: In general, why is it important to regulate genes? Discuss

In general, why is it important to regulate genes? Discuss examples of situations in which it would be advantageous for a bacterial cell to regulate genes.

Q: What is a viral envelope? Describe how it is made.

What is a viral envelope? Describe how it is made.

Q: Explain why the events shown in part (a) inhibit transcription

Explain why the events shown in part (a) inhibit transcription. From Figure 15.15a:

Q: What do the terms host cell and host range mean?

What do the terms host cell and host range mean?

Q: Describe why the attachment step in a viral reproductive cycle is usually

Describe why the attachment step in a viral reproductive cycle is usually specific for one or just a few cell types.

Q: Compare and contrast the entry step of the viral reproductive cycle of

Compare and contrast the entry step of the viral reproductive cycle of phage λ and HIV.

Q: What is the role of reverse transcriptase in the reproductive cycle of

What is the role of reverse transcriptase in the reproductive cycle of HIV and other retroviruses?

Q: Describe how lytic bacteriophages are released from their host cells.

Describe how lytic bacteriophages are released from their host cells.

Q: Is each of the following mutations a transition, transversion, addition

Is each of the following mutations a transition, transversion, addition, or deletion? The original DNA strand is 5′–GGACTAGATAC–3′ (Note: Only the coding DNA strand is shown.) A. 5′–GAACTAGATAC–3′...

Q: Explain two ways that a chromosomal rearrangement can cause a position effect

Explain two ways that a chromosomal rearrangement can cause a position effect.

Q: Is a random mutation more likely to be beneficial or harmful?

Is a random mutation more likely to be beneficial or harmful? Explain your answer.

Q: Which of the following mutations could be appropriately described as a position

Which of the following mutations could be appropriately described as a position effect? A. A point mutation at the –10 position in the promoter region prevents transcription. B. A translocation place...

Q: As discussed in Chapter 25, most forms of cancer are caused

As discussed in Chapter 25, most forms of cancer are caused by environmental agents that produce mutations in somatic cells. Is an individual with cancer considered a genetic mosaic? Explain why or wh...

Q: What is the difference between de novo methylation and maintenance methylation?

What is the difference between de novo methylation and maintenance methylation?

Q: Discuss the consequences of a germ-line versus a somatic mutation

Discuss the consequences of a germ-line versus a somatic mutation.

Q: Make a drawing that shows how alkylating agents alter the structure of

Make a drawing that shows how alkylating agents alter the structure of DNA, and explain the process.

Q: Explain how a mutagen can interfere with DNA replication to cause a

Explain how a mutagen can interfere with DNA replication to cause a mutation. Give two examples.

Q: What type of mutation (transition, transversion, or frameshift)

What type of mutation (transition, transversion, or frameshift) would you expect each of the following mutagens to cause? A. Nitrous acid B. 5-Bromouracil C. Proflavin

Q: Explain what happens to the sequence of DNA during trinucleotide repeat expansion

Explain what happens to the sequence of DNA during trinucleotide repeat expansion (TNRE). If someone was mildly affected with a TNRE disorder, what issues would be important when considering possible...

Q: Distinguish between spontaneous and induced mutations. Which are more harmful?

Distinguish between spontaneous and induced mutations. Which are more harmful? Which are avoidable?

Q: A gene mutation changes an AT base pair to GC. This

A gene mutation changes an AT base pair to GC. This change causes a gene to encode a truncated protein that is nonfunctional. An organism that carries this mutation cannot survive at high temperatures...

Q: Are mutations random events? Explain your answer.

Are mutations random events? Explain your answer.

Q: Give an example of a mutagen that can change cytosine to uracil

Give an example of a mutagen that can change cytosine to uracil. Which DNA repair system(s) would be able to repair this defect?

Q: If a mutagen causes bases to be removed from nucleotides within DNA

If a mutagen causes bases to be removed from nucleotides within DNA, what repair system would fix this damage?

Q: What is the difference between an ancestral character and a shared derived

What is the difference between an ancestral character and a shared derived character?

Q: Why are insulators important for gene regulation in eukaryotes?

Why are insulators important for gene regulation in eukaryotes?

Q: Trinucleotide repeat expansions (TNREs) are associated with several different human

Trinucleotide repeat expansions (TNREs) are associated with several different human inherited diseases. Certain types of TNREs produce a long stretch of the amino acid glutamine within the encoded pro...

Q: With regard to TNRE, what is meant by the term anticipation

With regard to TNRE, what is meant by the term anticipation?

Q: What is the difference between the mutation rate and the mutation frequency

What is the difference between the mutation rate and the mutation frequency?

Q: Achondroplasia is a rare form of dwarfism. It is caused by

Achondroplasia is a rare form of dwarfism. It is caused by an autosomal dominant mutation within a single gene. Among 1,422,000 live births, the number of babies born with achondroplasia was 31. Among...

Q: What does a suppressor mutation suppress? What is the difference between

What does a suppressor mutation suppress? What is the difference between an intragenic and an intergenic suppressor?

Q: How would each of the following types of mutations affect protein function

How would each of the following types of mutations affect protein function or the amount of functional protein that is expressed from a gene? A. Nonsense mutation B. Missense mutation C. Up promote...

Q: X-rays strike a chromosome in a living cell and ultimately

X-rays strike a chromosome in a living cell and ultimately cause the cell to die. Did the X-rays produce a mutation? Explain why or why not.

Q: Lactose permease is encoded by the lacY gene of the lac operon

Lactose permease is encoded by the lacY gene of the lac operon. Suppose a mutation occurred at codon 64 that changed the normal glycine codon into a valine codon. The mutant lactose permease is unable...

Q: Is each of the following mutations a silent, missense, nonsense

Is each of the following mutations a silent, missense, nonsense, or frameshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the first codon is me...

Q: A point mutation occurs in the middle of the coding sequence for

A point mutation occurs in the middle of the coding sequence for a gene. Which types of mutations—silent, missense, nonsense, and frameshift—would be most likely to disrupt protein function and which...

Q: If a mutation prevented IRP from binding to the IRE in the

If a mutation prevented IRP from binding to the IRE in the ferritin mRNA, how would the mutation affect the regulation of ferritin synthesis? Do you think there would be too much or too little ferriti...

Q: In Chapters 12 through 16, we discussed many sequences that are

In Chapters 12 through 16, we discussed many sequences that are outside a coding sequence but are important for gene expression. Look up two of these sequences and write them out. Explain how a mutati...

Q: Describe the similarities and differences between homologous recombination involving sister chromatid exchange

Describe the similarities and differences between homologous recombination involving sister chromatid exchange (SCE) and that involving homologs. Would you expect the same types of proteins to be invo...

Q: The molecular mechanism of SCE is similar to homologous recombination between homologs

The molecular mechanism of SCE is similar to homologous recombination between homologs except that the two segments of DNA are sister chromatids instead of homologous chromatids. If branch migration o...

Q: Which steps in the double-strand break model for recombination would

Which steps in the double-strand break model for recombination would be inhibited if the following proteins were missing? Explain the function of each protein required for the step that is inhibited....

Q: What two molecular mechanisms can result in gene conversion? Do both

What two molecular mechanisms can result in gene conversion? Do both occur in the double-strand break model?

Q: Is homologous recombination an example of mutation? Explain.

Is homologous recombination an example of mutation? Explain.

Q: Discuss three important advances that have resulted from gene cloning

Discuss three important advances that have resulted from gene cloning

Q: In recombinant chromosomes, where is gene conversion likely to take place

In recombinant chromosomes, where is gene conversion likely to take place: near the breakpoint or far away from the breakpoint? Explain.

Q: What events does the RecA protein facilitate?

What events does the RecA protein facilitate?

Q: According to the double-strand break model, does gene conversion

According to the double-strand break model, does gene conversion necessarily involve DNA mismatch repair? Explain.

Q: During which step of the reproductive cycle can a virus remain latent

During which step of the reproductive cycle can a virus remain latent?

Q: What is a restriction enzyme? What structure does it recognize?

What is a restriction enzyme? What structure does it recognize? What type of chemical bond does it cleave? Be as specific as possible.

Q: Write a double-stranded DNA sequence that is 20 base pairs

Write a double-stranded DNA sequence that is 20 base pairs in length and is palindromic.

Q: What is cDNA? In eukaryotes, how does cDNA differ from

What is cDNA? In eukaryotes, how does cDNA differ from genomic DNA?

Q: Draw the structural feature of a dideoxyribonucleotide that causes chain termination.

Draw the structural feature of a dideoxyribonucleotide that causes chain termination. Explain how it does this.

Q: What are recombinant chromosomes? How do they differ from the original

What are recombinant chromosomes? How do they differ from the original parental chromosomes from which they are derived?

Q: In the Holliday model for homologous recombination, the resolution steps can

In the Holliday model for homologous recombination, the resolution steps can produce recombinant or nonrecombinant chromosomes. Explain how this can occur.

Q: What is gene conversion?

What is gene conversion?

Q: Make a list of the differences between the Holliday model and the

Make a list of the differences between the Holliday model and the double-strand break model.

Q: What is a recombinant microorganism? Discuss examples.

What is a recombinant microorganism? Discuss examples.

Q: A conjugation-deficient strain of A. radiobacter is used to

A conjugation-deficient strain of A. radiobacter is used to combat crown gall disease. Explain how this bacterium prevents the disease, and describe the advantage of using a conjugation-deficient stra...

Q: Which cycle produces new phage particles?

Which cycle produces new phage particles?

Q: What is bioremediation? What is the difference between biotransformation and biodegradation

What is bioremediation? What is the difference between biotransformation and biodegradation?

Q: A person with a rare genetic disease has a sample of her

A person with a rare genetic disease has a sample of her chromosomes subjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes l...

Q: For each of the following, decide if it could be appropriately

For each of the following, decide if it could be appropriately described as a genome: A. The E. coli chromosome B. Human chromosome 11 C. A complete set of 10 chromosomes in corn D. A copy of the...

Q: Which of the following statements about molecular markers are true?

Which of the following statements about molecular markers are true? A. All molecular markers are segments of DNA that carry specific genes. B. A molecular marker is a segment of DNA that is found at...

Q: What is a biological control agent? Briefly describe two examples.

What is a biological control agent? Briefly describe two examples.

Q: Two populations of snakes are separated by a river. The snakes

Two populations of snakes are separated by a river. The snakes cross the river only on rare occasions. The snakes in the two populations look very similar to each other, except that the members of the...

Q: Sympatric speciation by allotetraploidy has been proposed as a common mechanism for

Sympatric speciation by allotetraploidy has been proposed as a common mechanism for speciation. Let’s suppose you were interested in the origin of certain grass species in southern California. Experim...

Q: Two diploid species of closely related frogs, which we will call

Two diploid species of closely related frogs, which we will call species A and species B, were analyzed with regard to the genes that encode an enzyme called hexokinase. Species A has two distinct cop...

Q: A researcher sequenced a portion of a bacterial gene and obtained the

A researcher sequenced a portion of a bacterial gene and obtained the following sequence, beginning with the start codon, which is underlined: ATG CCG GAT TAC CCG GTC CCA AAC AAA ATG ATC GGC CGC CGA...

Q: F1 hybrids between two species of cotton, Gossypium barbadense and Gossypium

F1 hybrids between two species of cotton, Gossypium barbadense and Gossypium hirsutum, are very vigorous plants. However, F1 crosses produce many seeds that do not germinate and a high percentage of v...

Q: What is meant by the term emerging virus?

What is meant by the term emerging virus?

Q: A species of antelope has 20 chromosomes per set. The species

A species of antelope has 20 chromosomes per set. The species is divided by a mountain range into two separate populations, which we will call the eastern and western population. In a comparison of th...

Q: Explain why molecular techniques were needed to provide evidence for the neutral

Explain why molecular techniques were needed to provide evidence for the neutral theory of evolution.

Q: Prehistoric specimens often contain minute amounts of ancient DNA. What technique

Prehistoric specimens often contain minute amounts of ancient DNA. What technique can be used to increase the amount of DNA in an older sample? Explain how this technique is performed and how it incre...

Q: From the results of the experiment of Figure 29.13,

From the results of the experiment of Figure 29.13, explain how we know that the kiwis are more closely related to the emu and cassowary than to the moas. Cite particular regions in the sequences that...

Q: In Chapter 23, a technique called fluorescence in situ hybridization (

In Chapter 23, a technique called fluorescence in situ hybridization (FISH) is described. In this method, a labeled piece of DNA is hybridized to a set of chromosomes. Let’s suppose...

Q: A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex

A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers for the 12S rRNA mitochondrial gene, they carried out PCR and obt...

Q: Discuss how the principle of parsimony can be used in a cladistics

Discuss how the principle of parsimony can be used in a cladistics approach to constructing a phylogenetic tree.

Q: A homologous DNA region, which was 20,000 bp in

A homologous DNA region, which was 20,000 bp in length, was sequenced from four different species. The following numbers of nucleotide differences were obtained: Construct a phylogenetic tree that de...

Q: As discussed in this chapter and Chapter 27, genes are sometimes

As discussed in this chapter and Chapter 27, genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might lead to misleading resul...

Q: What would you expect to be the minimum percentage of matching peaks

What would you expect to be the minimum percentage of matching peaks in an automated DNA fingerprint for the following pairs of individuals? A. Mother and son B. Sister and brother C. Uncle and nie...

Q: Let’s suppose a drug inhibits the function of the N protein.

Let’s suppose a drug inhibits the function of the N protein. Would such a drug favor the lysogenic cycle, favor the lytic cycle, or prevent both cycles from occurring?

Q: Take a look at question 3 in More Genetic TIPS and the

Take a look at question 3 in More Genetic TIPS and the codon table in Chapter 13. Assuming that a mutation causing a single base change is more likely than one causing a double base change, propose ho...

Q: Four cosmid clones, which we will call cosmids A, B

Four cosmid clones, which we will call cosmids A, B, C, and D, were hybridized to each other in pairwise combinations. The insert size of each cosmid was also analyzed. The following results were obta...

Q: A human gene, which we will call gene X, is

A human gene, which we will call gene X, is located on chromosome 11 and is found as a normal allele and a recessive disease causing allele. The location of gene X has been approximated on the map sho...

Q: Describe how you would clone a gene by positional cloning. Explain

Describe how you would clone a gene by positional cloning. Explain how a (previously made) contig would make this task much easier.

Q: A bacterium has a genome size of 4.4 Mb.

A bacterium has a genome size of 4.4 Mb. If a researcher carries out shotgun DNA sequencing and sequences a total of 19 Mb, what is the probability that a base will be left unsequenced? What percentag...

Q: Discuss the advantages of next-generation sequencing technologies

Discuss the advantages of next-generation sequencing technologies

Q: What is meant by sequencing by synthesis?

What is meant by sequencing by synthesis?

Q: Outline the general strategy used in metagenomics.

Outline the general strategy used in metagenomics.

Q: If you wanted to know if a protein was made during a

If you wanted to know if a protein was made during a particular stage of development, what technique would you choose?

Q: Let’s suppose a researcher was interested in the effects of mutations on

Let’s suppose a researcher was interested in the effects of mutations on the expression of a protein-encoding gene that encodes a polypeptide that is 472 amino acids in length. This polypeptide is exp...

Q: What environmental conditions favor a switch to the lytic cycle?

What environmental conditions favor a switch to the lytic cycle?

Q: Explain the basis for using an antibody as a probe in a

Explain the basis for using an antibody as a probe in a Western blotting experiment.

Q: A cloned gene fragment contains a regulatory element that is recognized by

A cloned gene fragment contains a regulatory element that is recognized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional...

Q: Describe the rationale behind the electrophoretic mobility shift assay.

Describe the rationale behind the electrophoretic mobility shift assay.

Q: Certain hormones, such as epinephrine, can increase the levels of

Certain hormones, such as epinephrine, can increase the levels of cAMP within cells. Let’s suppose you pretreat cells with or without epinephrine and then prepare a cell extract that contains the CREB...

Q: An electrophoretic mobility shift assay can be used to study the binding

An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the experiment shown here, an EMSA was used to examine the requirements for the binding of...

Q: As described in Chapter 15 (Figures 15.7 and 15

As described in Chapter 15 (Figures 15.7 and 15.8), certain regulatory transcription factors bind to DNA and activate RNA polymerase II. When glucocorticoid binds to the glucocorticoid receptor (a reg...

Q: In the technique of DNase I footprinting, the binding of a

In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In th...

Q: Explain the rationale behind a DNase I footprinting experiment.

Explain the rationale behind a DNase I footprinting experiment.

Q: What is miRNA replacement therapy? Describe three examples of this treatment

What is miRNA replacement therapy? Describe three examples of this treatment approach.

Q: Researchers can introduce loss-of-function mutations into genes using

Researchers can introduce loss-of-function mutations into genes using the CRISPR/Cas9 technology described in Chapter 21. If you used this technology to produce the following homozygous loss-of-functi...

Q: What are the two enzymatic functions of reverse transcriptase?

What are the two enzymatic functions of reverse transcriptase?

Q: Answer the following questions that pertain to the experiment of Figure 14

Answer the following questions that pertain to the experiment of Figure 14.7. A. Why was β-ONPG used? Why was no yellow color observed in one of the four tubes? Can you propose alternativ...

Q: Chapter 21 describes a blotting method known as Northern blotting, which

Chapter 21 describes a blotting method known as Northern blotting, which can be used to detect RNA transcribed from a particular gene or a particular operon. In this method, a specific RNA is detected...

Q: Discuss how researchers determined that TMV is a virus that causes damage

Discuss how researchers determined that TMV is a virus that causes damage to plants.

Q: What technique must be used to visualize a virus?

What technique must be used to visualize a virus?

Q: The raw material for evolution is random mutation. Discuss whether or

The raw material for evolution is random mutation. Discuss whether or not you view evolution as a random process.

Q: Compare the forms of speciation that are slow to those that occur

Compare the forms of speciation that are slow to those that occur more rapidly. Make a list of the slow and fast forms. With regard to mechanisms of genetic change, what features do slow and rapid spe...

Q: Do you think that Darwin would object to the neutral theory of

Do you think that Darwin would object to the neutral theory of evolution?

Q: Looking at Figure 14.10, discuss possible “molecular ways

Looking at Figure 14.10, discuss possible “molecular ways” that the cAMP-CAP complex and lac repressor may influence RNA polymerase function. In other words, try to...

Q: Explain how DNA methylation could be used to regulate gene expression in

Explain how DNA methylation could be used to regulate gene expression in a tissue-specific way. When and where would de novo methylation occur, and when would demethylation occur? What would occur in...

Q: Enhancers can occur almost anywhere in DNA and affect the transcription of

Enhancers can occur almost anywhere in DNA and affect the transcription of a gene. Let’s suppose you have a gene cloned on a piece of DNA, and the DNA fragment is 50,000 bp in length. Using cloning me...

Q: Which form of HIV RNA, fully spliced, incompletely spiced,

Which form of HIV RNA, fully spliced, incompletely spiced, or unspliced, is needed during the early stage of the synthesis of HIV components?

Q: Go to the PubMed website and search using the words epigenetic and

Go to the PubMed website and search using the words epigenetic and cancer. Scan through the journal articles you retrieve, and make a list of environmental agents that may cause epigenetic changes tha...

Q: Discuss the similarities and differences of phenotypic variations that are caused by

Discuss the similarities and differences of phenotypic variations that are caused by epigenetic gene regulation versus variation in gene sequences (epigenetics versus genetics).

Q: Review the concept of an RNA world described in Section 17.

Review the concept of an RNA world described in Section 17.1. Discuss which ncRNAs described in Table 17.1 may have arisen during the RNA world, and which probably arose after the modern DNA/RNA/prote...

Q: Go to the PubMed website and do a search using the words 

Go to the PubMed website and do a search using the words noncoding RNA and disease. Scan through the journal articles you retrieve and make a list of the roles that ncRNAs may play in human diseases....

Q: Discuss the advantages and disadvantages of genetic regulation at the different points

Discuss the advantages and disadvantages of genetic regulation at the different points identified in Figure 14.1. From Figure 14.1:

Q: Discuss the properties of emerging viruses. What are the challenges associated

Discuss the properties of emerging viruses. What are the challenges associated with combating them?

Q: Certain environmental conditions such as exposure to UV light are known to

Certain environmental conditions such as exposure to UV light are known to activate lysogenic λ prophages and cause them to progress into the lytic cycle. UV light initially causes the repressor prote...

Q: Browse the Internet to determine the drugs that are used to treat

Browse the Internet to determine the drugs that are used to treat people with AIDS. Which proteins do these drugs affect? Discuss how an understanding of the HIV reproductive cycle has been helpful in...

Q: In E. coli, a variety of mutator strains have been

In E. coli, a variety of mutator strains have been identified in which the spontaneous rate of mutation is much higher than in normal strains. Make a list of the types of abnormalities that could caus...

Q: Discuss the times in a person’s life when it is most important

Discuss the times in a person’s life when it is most important to avoid mutagens. Which parts of a person’s body should be the most highly protected from mutagens?

Q: What is the function of PRM?

What is the function of PRM?

Q: A large amount of research is aimed at studying mutation. However

A large amount of research is aimed at studying mutation. However, there is not an infinite amount of research money. Where would you put your money for mutation research? A. Testing of potential mut...

Q: Make a list of the similarities and differences among homologous recombination,

Make a list of the similarities and differences among homologous recombination, site-specific recombination, and transposition.

Q: If homologous and site-specific recombination could not occur, what

If homologous and site-specific recombination could not occur, what would be the harmful and the beneficial consequences?

Q: Discuss and make a list of some of the reasons why determining

Discuss and make a list of some of the reasons why determining the amount of a particular gene product would be useful to a geneticist. Use specific examples of known genes (e.g., β-globin gene and ot...

Q: Make a list of possible research questions that could be answered using

Make a list of possible research questions that could be answered using site-directed mutagenesis or CRISPR-Cas technology.

Q: Based on your current knowledge of genetics, discuss whether or not

Based on your current knowledge of genetics, discuss whether or not you think the selfish DNA hypothesis is correct.

Q: Discuss the advantages and disadvantages of gene therapy. A limited amount

Discuss the advantages and disadvantages of gene therapy. A limited amount of funding is available for gene therapy research. Make a priority list of the three top diseases for which you would fund re...

Q: A commercially available strain of P. syringae marketed as Frostban B

A commercially available strain of P. syringae marketed as Frostban B is used to combat frost damage. This is a naturally occurring strain that carries a loss-of-function mutation in a gene that encod...

Q: What is a molecular marker? Give two examples. Discuss why

What is a molecular marker? Give two examples. Discuss why it is generally easier to locate and map molecular markers rather than functional genes.

Q: Which goals of the Human Genome Project do you think are the

Which goals of the Human Genome Project do you think are the most important? Why? Discuss the types of ethical problems that might arise as a result of identifying all of our genes.

Q: What is the principle of parsimony?

What is the principle of parsimony?

Q: Explain what the term position effect means.

Explain what the term position effect means.

Q: Make a list of the benefits that may arise from genetic testing

Make a list of the benefits that may arise from genetic testing as well as possible negative consequences. Discuss the items on your list.

Q: Let’s suppose you are in charge of organizing and publicizing a database

Let’s suppose you are in charge of organizing and publicizing a database for the mouse genome. Make a list of innovative strategies you would initiate to make the mouse genome database useful and effe...

Q: If you have access to the necessary computer software, make a

If you have access to the necessary computer software, make a sequence file and analyze it in the following ways: What is the translated sequence in all three reading frames? What is the longest open...

Q: Make a list of the types of traits you would like to

Make a list of the types of traits you would like to see altered in transgenic plants and animals. Suggest techniques to accomplish these alterations.

Q: Compare and contrast the experimental advantages and disadvantages of Drosophila, C

Compare and contrast the experimental advantages and disadvantages of Drosophila, C. elegans, mammals, and Arabidopsis.

Q: It seems that developmental genetics boils down to a complex network of

It seems that developmental genetics boils down to a complex network of gene regulation. Try to draw a structure of this network for Drosophila. How many genes do you think are necessary to complete t...

Q: At the molecular level, how do you think a gain-

At the molecular level, how do you think a gain-of-function mutation in a developmental gene might cause it to be expressed in the wrong place or at the wrong time? Explain what type of DNA sequence w...

Q: Discuss examples of positive and negative assortative mating in natural populations,

Discuss examples of positive and negative assortative mating in natural populations, human populations, and agriculturally important species.

Q: Discuss the role of mutation in the origin of genetic polymorphisms.

Discuss the role of mutation in the origin of genetic polymorphisms. Suppose that a genetic polymorphism involves two alleles at frequencies of 0.45 and 0.55. Describe three different scenarios to exp...

Q: Most new mutations are detrimental, yet rare beneficial mutations can be

Most new mutations are detrimental, yet rare beneficial mutations can be adaptive. With regard to the fate of new mutations, discuss whether you think it is more important for natural selection to sel...

Q: Has the DNA sequence of the eye color gene been changed in

Has the DNA sequence of the eye color gene been changed in part (b) compared with part (a)? How do we explain the phenotypic difference? From Figure 19.3:

Q: Discuss why heritability is an important phenomenon in agriculture.

Discuss why heritability is an important phenomenon in agriculture.

Q: From a biological viewpoint, speculate as to why many traits seem

From a biological viewpoint, speculate as to why many traits seem to fit a normal distribution. Students with a strong background in math and statistics may want to explain how a normal distribution i...

Q: What is heterosis? Discuss whether it is caused by a single

What is heterosis? Discuss whether it is caused by a single gene or several genes. Discuss the two major hypotheses proposed to explain heterosis. Which do you think is more likely to be correct?

Q: What is a reconstituted virus?

What is a reconstituted virus?

Q: Following the infection of healthy tobacco leaves by reconstituted viruses, what

Following the infection of healthy tobacco leaves by reconstituted viruses, what two characteristics did Fraenkel-Conrat and Singer analyze? Explain how their results were consistent with the idea tha...

Q: Certain drugs to combat human viral diseases affect spike glycoproteins in the

Certain drugs to combat human viral diseases affect spike glycoproteins in the viral envelope. Discuss how you think such drugs may prevent viral infection.

Q: Some drugs that inhibit HIV proliferation are inhibitors of HIV protease.

Some drugs that inhibit HIV proliferation are inhibitors of HIV protease. Explain how these drugs would help to stop the spread of HIV.

Q: Explain how the technique of replica plating supports the random mutation theory

Explain how the technique of replica plating supports the random mutation theory but conflicts with the physiological adaptation hypothesis.

Q: Outline how you would use the technique of replica plating to show

Outline how you would use the technique of replica plating to show that antibiotic resistance is due to random mutations.

Q: From an experimental point of view, is it better to use

From an experimental point of view, is it better to use haploid or diploid organisms for mutagen testing? Consider the Ames test when preparing your answer.

Q: Can this trait be passed to offspring?

Can this trait be passed to offspring?

Q: How would you modify the Ames test to evaluate physical mutagens?

How would you modify the Ames test to evaluate physical mutagens? Would it be necessary to add the rat liver extract? Explain why or why not.

Q: During an Ames test, bacteria were exposed to a potential mutagen

During an Ames test, bacteria were exposed to a potential mutagen. Also, as a control, another sample of bacteria was not exposed to the mutagen. In both cases, 10 million bacteria were plated and the...

Q: Briefly explain how McClintock determined that Ds was occasionally moving from one

Briefly explain how McClintock determined that Ds was occasionally moving from one chromosomal location to another. Discuss the type of data she examined to arrive at this conclusion.

Q: This question combines your knowledge of bacterial conjugation (described in Chapter

This question combines your knowledge of bacterial conjugation (described in Chapter 7) and the genetic regulation that directs the phage λ reproductive cycles. When researchers mix donor Hfr strains...

Q: An absentminded researcher follows the protocol described in Figure 14.7

An absentminded researcher follows the protocol described in Figure 14.7 and (at the end of the experiment) does not observe any yellow color in any of the tubes. Yikes! Which of the following mistake...

Q: Explain how the data shown in Figure 14.9 indicate that

Explain how the data shown in Figure 14.9 indicate that two operator sites are necessary for repression of the lac operon. What would the results have been if all three operator sites were required fo...

Q: A mutant strain has a defective lac operator site that results in

A mutant strain has a defective lac operator site that results in the constitutive expression of the lac operon. Outline an experiment you would carry out to demonstrate that the operator site must be...

Q: Let’s suppose you have isolated a mutant strain of E. coli

Let’s suppose you have isolated a mutant strain of E. coli in which the lac operon is constitutively expressed. To understand the nature of this defect, you create a merozygote in wh...

Q: Briefly describe the method of chromatin immunoprecipitation sequencing (ChIP-Seq

Briefly describe the method of chromatin immunoprecipitation sequencing (ChIP-Seq). How is it used to determine nucleosome positions within a genome?

Q: Researchers can isolate a sample of cells, such as skin fibroblasts

Researchers can isolate a sample of cells, such as skin fibroblasts, and grow them in the laboratory. This procedure is called a cell culture. A cell culture can be exposed to a sample of DNA. If the...

Q: When DNA replication occurs over an apurinic site, what is the

When DNA replication occurs over an apurinic site, what is the probability that a mutation will occur?

Q: Restriction enzymes, described in Chapter 21, are enzymes that recognize

Restriction enzymes, described in Chapter 21, are enzymes that recognize a particular DNA sequence and cleave the DNA (along the DNA backbone) at that site. The restriction enzyme known as NotI recogn...

Q: You will need to understand question 3 in More Genetic TIPS before

You will need to understand question 3 in More Genetic TIPS before answering this question. A muscle-specific gene was cloned and then subjected to promoter bashing. As shown here, six regions, labele...

Q: You will need to understand question 3 in More Genetic TIPS before

You will need to understand question 3 in More Genetic TIPS before answering this question. A gene that is normally expressed in pancreatic cells was cloned and then subjected to promoter bashing. As...

Q: The work of McClintock showed that the presence of a transposon can

The work of McClintock showed that the presence of a transposon can create a mutable site or locus that is subject to frequent chromosome breakage. Why do you think a transposon creates a mutable site...

Q: As described in Chapter 21, an electrophoretic mobility shift assay (

As described in Chapter 21, an electrophoretic mobility shift assay (EMSA) can be used to determine if a protein binds to a segment of DNA. When a segment of DNA is bound by a protein, its mobility wi...

Q: Chapter 21 describes a blotting method known as Northern blotting, in

Chapter 21 describes a blotting method known as Northern blotting, in which a short segment of cloned DNA is used as a probe to detect RNA that is transcribed from a particular gene. The DNA probe, wh...

Q: A gene, which we will call gene C, can be

A gene, which we will call gene C, can be epigenetically modified in such a way that its expression in some cells is permanently silenced. Describe how you could conduct cell-fusion experiments to det...

Q: In the experiments described in Figure 16.8, explain the

In the experiments described in Figure 16.8, explain the relationship between coat color and DNA methylation. How is coat color related to the diet of the mother? From Figure 16.8:

Q: 5-Azocytidine is an inhibitor of DNA methyltransferase. If this

5-Azocytidine is an inhibitor of DNA methyltransferase. If this drug were fed to female mice during pregnancy, explain how you think it would affect the coat color of offspring carrying the Avy allele...

Q: A research study indicated that an agent in cigarette smoke caused the

A research study indicated that an agent in cigarette smoke caused the silencing of a tumor-suppressor gene called p53. However, using sequencing, no mutation was found in the DNA sequence for this ge...

Q: Which of these two changes is more difficult for DNA repair enzymes

Which of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why

Q: Let’s suppose you were interested in developing drugs to prevent epigenetic changes

Let’s suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs? What possible side effects...

Q: Look back at Figure 16.7. If you crossed an

Look back at Figure 16.7. If you crossed an F2 offspring to a homozygous B-I B-I plant, what phenotypic results would you expect for the F3 offspring? From Figure 16.7:

Q: A protein called trypsin, which plays a role in digestion,

A protein called trypsin, which plays a role in digestion, is made by pancreatic cells and secreted from those cells. Starting with a sample of pancreatic cells, a researcher modified the gene that en...

Q: As described in experimental question E2 and also in Chapter 21,

As described in experimental question E2 and also in Chapter 21, the technique of Northern blotting can be used to detect the level of transcription of a specific RNA. Draw the results you would expec...

Q: In your own words, explain the term transposon tagging.

In your own words, explain the term transposon tagging.

Q: In Experiment 17A, were Fire and Mello injecting pre-miRNA

In Experiment 17A, were Fire and Mello injecting pre-miRNA or pre-siRNA? Explain.

Q: Explain how the data of Fire and Mello suggested that doublestranded RNA

Explain how the data of Fire and Mello suggested that doublestranded RNA is responsible for the silencing of mex-3 mRNA.

Q: As described in Chapter 21, the CRISPR-Cas system has

As described in Chapter 21, the CRISPR-Cas system has been modified so it can be used as a gene mutagenesis tool (look ahead to Figure 21.13). Describe how the gene mutagenesis tool works, and explain...

Q: Compare and contrast anti-miRNA oligonucleotides, locked nucleic acids (

Compare and contrast anti-miRNA oligonucleotides, locked nucleic acids (LNAs), and antagomirs, which may eventually be used to treat certain forms of cancer. 

Q: Tumor-suppressor genes are normal human genes that prevent uncontrollable cell

Tumor-suppressor genes are normal human genes that prevent uncontrollable cell growth. Starting with a normal laboratory human cell line, describe how you could use transposon tagging to identify tumo...

Q: What is a reactive oxygen species?

What is a reactive oxygen species?

Q: Gerald Rubin and Allan Spradling devised a method of introducing a transposon

Gerald Rubin and Allan Spradling devised a method of introducing a transposon into Drosophila. This approach has been important for the transposon tagging of many Drosophila genes. The researchers beg...

Q: Richard Boyce and Paul Howard-Flanders conducted an experiment that provided

Richard Boyce and Paul Howard-Flanders conducted an experiment that provided biochemical evidence that thymine dimers are removed from DNA by a DNA repair system. In their studies, bacterial DNA was r...

Q: A researcher identified a mutation in PR of phage λ that causes

A researcher identified a mutation in PR of phage λ that causes its transcription rate to be increased 10-fold. Do you think this mutation would favor the lytic or lysogenic cycle? Explain your answer...

Q: Experimentally, when an E. coli bacterium already has a λ

Experimentally, when an E. coli bacterium already has a λ prophage integrated into its chromosome, another λ phage cannot usually infect the cell and establish the lysogenic or lytic cycle. Based on y...

Q: A bacterium is exposed to a drug that inhibits the N protein

A bacterium is exposed to a drug that inhibits the N protein. What would you expect to happen if the bacterium was later infected by phage λ? Would phage λ follow the lytic cycle, the lysogenic cycle,...

Q: What is the functional significance of sticky ends in a cloning experiment

What is the functional significance of sticky ends in a cloning experiment? What type of bonding makes the ends sticky?

Q: Starting with a sample of RNA that contains the mRNA for the

Starting with a sample of RNA that contains the mRNA for the β-globin gene, explain how you could create many copies of the β-globin cDNA using reverse transcriptase PCR.

Q: What type of probe is used for real-time PCR?

What type of probe is used for real-time PCR? Explain how the level of fluorescence correlates with the level of PCR product.

Q: What phase of PCR (exponential, linear, or stationary)

What phase of PCR (exponential, linear, or stationary) is analyzed to quantitate the amount of DNA or RNA in a sample? Explain why this phase is chosen.

Q: DNA sequencing can help us to identify mutations within genes. The

DNA sequencing can help us to identify mutations within genes. The following data are derived from an experiment in which a normal gene and a mutant gene have been sequenced: Locate and d...

Q: What is the advantage of genetic recombination, which is depicted in

What is the advantage of genetic recombination, which is depicted in part (b)? From Figure 20.1:

Q: Table 21.3 describes the cleavage sites of five different restriction

Table 21.3 describes the cleavage sites of five different restriction enzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with comple...

Q: Describe the important features of cloning vectors. Explain the purpose of

Describe the important features of cloning vectors. Explain the purpose of selectable markers in cloning experiments.

Q: How does gene cloning produce many copies of a gene?

How does gene cloning produce many copies of a gene?

Q: In your own words, describe the series of steps necessary to

In your own words, describe the series of steps necessary to clone a gene.

Q: What is a recombinant vector? How is a recombinant vector constructed

What is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.

Q: What is a DNA library? Do you think this name is

What is a DNA library? Do you think this name is appropriate?

Q: Some vectors used in cloning experiments contain bacterial promoters that are adjacent

Some vectors used in cloning experiments contain bacterial promoters that are adjacent to unique cloning sites. This makes it possible to insert a gene sequence next to the bacterial promoter and expr...

Q: Why is a thermostable form of DNA polymerase (e.g

Why is a thermostable form of DNA polymerase (e.g., Taq polymerase) used in PCR? Is it necessary to use a thermostable form of DNA polymerase in the dideoxy method or in sitedirected mutagenesis?

Q: Recombinant bacteria can produce hormones that are normally produced in humans.

Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how this is accomplished.

Q: What is reproductive cloning? Are identical twins in humans considered to

What is reproductive cloning? Are identical twins in humans considered to be clones? With regard to agricultural species, what are some potential advantages to reproductive cloning?

Q: Which of these repair systems is particularly valuable to plants?

Which of these repair systems is particularly valuable to plants?

Q: Researchers have identified a gene in humans that (when mutant)

Researchers have identified a gene in humans that (when mutant) causes severe dwarfism and mental impairment. This disorder is inherited in an autosomal recessive manner, and the mutant allele is know...

Q: Treatment of adenosine deaminase (ADA) deficiency is an example of

Treatment of adenosine deaminase (ADA) deficiency is an example of ex vivo gene therapy. Why is this therapy called ex vivo? Can ex vivo gene therapy be used to treat all inherited diseases? Explain....

Q: Several research studies are under way that involve the use of gene

Several research studies are under way that involve the use of gene therapies to inhibit the growth of cancer cells. As discussed in Chapter 25, oncogenes are mutant genes that are overexpressed and c...

Q: A sample of DNA was subjected to automated DNA sequencing and the

A sample of DNA was subjected to automated DNA sequencing and the output is shown here. What is the sequence of this DNA segment?

Q: A portion of the coding sequence of a cloned gene is shown

A portion of the coding sequence of a cloned gene is shown here: 5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄ 3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄ This portion of the gene encodes a polypeptide with the amino acid...

Q: Let’s suppose you want to use site-directed mutagenesis to investigate

Let’s suppose you want to use site-directed mutagenesis to investigate a DNA sequence that functions as a response element for hormone binding. From previous work, you have narrowed down the response...

Q: Gene mutagenesis is also used to explore the structure and function of

Gene mutagenesis is also used to explore the structure and function of proteins. For example, changes can be made to the coding sequence of a gene to determine how alterations in the amino acid sequen...

Q: Northern blotting depends on the phenomenon of the binding of a probe

Northern blotting depends on the phenomenon of the binding of a probe to mRNA. In this technique, explain why binding occurs.

Q: In Northern and Western blotting, what is the purpose of gel

In Northern and Western blotting, what is the purpose of gel electrophoresis?

Q: Bacillus thuringiensis makes toxins that kill insects. These toxins must be

Bacillus thuringiensis makes toxins that kill insects. These toxins must be applied several times during the growth season to prevent insect damage. As an alternative to repeated applications, one str...

Q: Explain why a heteroduplex region may be produced after branch migration occurs

Explain why a heteroduplex region may be produced after branch migration occurs.

Q: What is the purpose of a Northern blotting experiment? What types

What is the purpose of a Northern blotting experiment? What types of information can it tell you about the transcription of a gene?

Q: Let’s suppose an X-linked gene in mice exists as two

Let’s suppose an X-linked gene in mice exists as two alleles, which we will call B and b. X-chromosome inactivation, a process in which one X chromosome is turned off, occurs in the somatic cells of f...

Q: The method of Northern blotting is used to determine the amount and

The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of differen...

Q: In the Western blot shown here, proteins were isolated from red

In the Western blot shown here, proteins were isolated from red blood cells and muscle cells from two different individuals. One individual was unaffected, and the other suffered from a disease known...

Q: In the procedure in Figure 22.1, why was it

In the procedure in Figure 22.1, why was it necessary to link the coding sequence for the A or B chains to the sequence for β-galactosidase? How were the A or B chains separate...

Q: To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens

To produce transgenic plants, plant tissue is exposed to Agrobacterium tumefaciens and then grown in media containing kanamycin, carbenicillin, and plant growth hormones. Explain the purpose behind ea...

Q: List and briefly describe five methods for the introduction of cloned genes

List and briefly describe five methods for the introduction of cloned genes into plants.

Q: What is a gene knockout? Is an animal or plant with

What is a gene knockout? Is an animal or plant with a gene knockout a heterozygote or homozygote? What might you conclude if a gene knockout does not have a phenotypic effect?

Q: In the study of plants and animals, it is relatively common

In the study of plants and animals, it is relatively common for researchers to identify a gene using molecular techniques without knowing the function of the gene. In the case of mice, the function of...

Q: Evidence [see P. G. Shiels, A. J

Evidence [see P. G. Shiels, A. J. Kind, K. H. Campbell, et al. (1999), “Analysis of telomere lengths in cloned sheep,” Nature 399, 316– 317] suggests that Dolly may have been genetically older than he...

Q: Describe the structure and location of a D-loop.

Describe the structure and location of a D-loop.

Q: What is molecular pharming? Compared with the production of proteins by

What is molecular pharming? Compared with the production of proteins by bacteria, why might it be advantageous?

Q: Is each of the following a method used in linkage, cytogenetic

Is each of the following a method used in linkage, cytogenetic, or physical mapping? A. Fluorescence in situ hybridization (FISH) B. Conducting two-factor crosses to compute map distances C. Chromo...

Q: Describe the molecular features of a BAC cloning vector. What is

Describe the molecular features of a BAC cloning vector. What is the primary advantage of a BAC vector over a plasmid or viral vector?

Q: A woman has had five children with two different men. This

A woman has had five children with two different men. This group of seven individuals is analyzed with regard to three different STSs: STS-1 is 146 bp and 122 bp; STS-2 is 102 bp and 88 bp; and STS-3...

Q: An experimenter used primers that recognize nine different STSs to test their

An experimenter used primers that recognize nine different STSs to test their presence in five different BACs. The results are shown here. Draw a contig that maps the alignment of the five BACs.

Q: In the Human Genome Project, researchers have collected linkage data from

In the Human Genome Project, researchers have collected linkage data from many crosses in which the male was heterozygous for molecular markers and many crosses where the female was heterozygous for t...

Q: Take a look at question 3 in More Genetic TIPS. Let’s

Take a look at question 3 in More Genetic TIPS. Let’s suppose a male is heterozygous for two polymorphic sequence-tagged sites. STS-1 exists in two sizes: 211 bp and 289 bp. STS-2 al...

Q: Place the following stages of a physical mapping study in their most

Place the following stages of a physical mapping study in their most logical order: A. Clone large fragments of DNA to make a BAC library. B. Determine the DNA sequence of subclones from a cosmid li...

Q: What is an STS? How are STSs generated experimentally? What

What is an STS? How are STSs generated experimentally? What are the uses of STSs? Explain how a microsatellite can be a polymorphic STS.

Q: In an in situ hybridization experiment, what is the relationship between

In an in situ hybridization experiment, what is the relationship between the base sequence of the probe DNA and the site on the chromosomal DNA where the probe binds?

Q: Discuss where protists are found in this newer organization of eukaryotic species

Discuss where protists are found in this newer organization of eukaryotic species.

Q: Explain what happened to the b allele that allowed gene conversion to

Explain what happened to the b allele that allowed gene conversion to occur.

Q: Describe the technique of in situ hybridization. Explain how it can

Describe the technique of in situ hybridization. Explain how it can be used to map genes.

Q: The cells from a person’s malignant tumor were subjected to in situ

The cells from a person’s malignant tumor were subjected to in situ hybridization using a probe that recognizes a unique sequence on chromosome 14. The probe was detected only once in each of the cell...

Q: Figure 23.2 describes the technique of FISH. Why is

Figure 23.2 describes the technique of FISH. Why is it necessary to fix the cells (and the chromosomes inside of them) to the slides? What does it mean to fix them? Why is it necessary to denature the...

Q: Explain how DNA probes with different fluorescence emission wavelengths can be used

Explain how DNA probes with different fluorescence emission wavelengths can be used in a single FISH experiment to map the locations of two or more genes. This method is called chromosome painting. Ex...

Q: A researcher is interested in a gene found on human chromosome 21

A researcher is interested in a gene found on human chromosome 21. Describe the expected results of a FISH experiment using a probe that is complementary to this gene. How many spots would you see if...

Q: What is a contig? Explain how you would determine that two

What is a contig? Explain how you would determine that two clones in a contig are overlapping.

Q: Contigs are often made using BAC or cosmid vectors. What are

Contigs are often made using BAC or cosmid vectors. What are the advantages and disadvantages of these two types of vectors? Which type of contig would you make first, a BAC or cosmid contig? Explain....

Q: Which of the following experimental observations suggest that a disease has a

Which of the following experimental observations suggest that a disease has a genetic basis? A. The frequency of the disease is less likely in relatives that live apart compared with relatives that l...

Q: Section 25.1 discussed the types of experimental observations that suggest

Section 25.1 discussed the types of experimental observations that suggest a disease is inherited. Which of these observations do you find the least convincing? Which do you find the most convincing?...

Q: What is meant by the term genetic testing? How do testing

What is meant by the term genetic testing? How do testing at the protein level and testing at the DNA level differ? Describe five different techniques used in genetic testing.

Q: Which of these mechanisms causes the TE to increase in number?

Which of these mechanisms causes the TE to increase in number?

Q: A particular disease is found in a group of South American Indians

A particular disease is found in a group of South American Indians. During the 1920s, many of these people migrated to Central America. In the Central American group, the disease is never found. Discu...

Q: Chapter 21 describes a method known as Western blotting that can be

Chapter 21 describes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detec...

Q: An experimental assay for the blood-clotting protein called factor IX

An experimental assay for the blood-clotting protein called factor IX is available. A blood sample was obtained from each individual in the following pedigree. The amount of factor IX protein, shown w...

Q: Discuss ways to distinguish whether a particular form of cancer involves an

Discuss ways to distinguish whether a particular form of cancer involves an inherited predisposition or is due strictly to (postzygotic) somatic mutations. In your answer, consider that only one mutat...

Q: The codon change (Gly-12 to Val-12)

The codon change (Gly-12 to Val-12) in human rasH that converts it to oncogenic rasH has been associated with many types of cancers. For this reason, researchers would like to develop drugs to inhibit...

Q: Explain how DNA microarrays are used in molecular profiling of cancerous tumors

Explain how DNA microarrays are used in molecular profiling of cancerous tumors.

Q: With regard to DNA microarrays, answer the following questions:

With regard to DNA microarrays, answer the following questions: A. What is attached to the slide? Be specific about the number of spots, the lengths of DNA fragments, and the origin of the DNA fragme...

Q: In this chapter, we considered a computer program that translates a

In this chapter, we considered a computer program that translates a DNA sequence into a polypeptide sequence. Instead of running this program, a researcher could simply look the codons up in a genetic...

Q: To identify the following types of genetic occurrences, would a computer

To identify the following types of genetic occurrences, would a computer program use sequence recognition, pattern recognition, or both? A. Whether a segment of Drosophila DNA contains a P element (w...

Q: The goal of many computer programs is to identify sequence elements within

The goal of many computer programs is to identify sequence elements within a long segment of DNA. What is a sequence element? Give two examples. How is the specific sequence of a sequence element dete...

Q: What is the function of reverse transcriptase?

What is the function of reverse transcriptase?

Q: Take a look at the multiple-sequence alignment in Figure 24

Take a look at the multiple-sequence alignment in Figure 24.10 of the globin polypeptides, focusing on amino acids 101 to 148. A. Which of these amino acids are likely to be most important for globin...

Q: Refer to question 3 in More Genetic TIPS before answering this question

Refer to question 3 in More Genetic TIPS before answering this question. Based on the multiple-sequence alignment in Figure 24.10, what is/are the most probable time(s) that mutations occurred in the...

Q: In the procedure called RNA sequencing (RNA-Seq), what

In the procedure called RNA sequencing (RNA-Seq), what type of molecule is actually sequenced?

Q: Can two-dimensional gel electrophoresis be used as a purification technique

Can two-dimensional gel electrophoresis be used as a purification technique? Explain.

Q: Explain how tandem mass spectroscopy is used to determine the sequence of

Explain how tandem mass spectroscopy is used to determine the sequence of a peptide. Once a peptide sequence is known, how is this information used to determine the sequence of the entire protein?

Q: Does 5-bromouracil cause a transition or a transversion?

Does 5-bromouracil cause a transition or a transversion?

Q: In people, what is a common cause of thymine dimer formation

In people, what is a common cause of thymine dimer formation and in what cell type(s) would it be most likely to occur?

Q: What is the purpose of the rat liver extract in this procedure

What is the purpose of the rat liver extract in this procedure?

Q: Prior to the action of DNA ligase, how many hydrogen bonds

Prior to the action of DNA ligase, how many hydrogen bonds are holding these two DNA fragments together?

Q: Explain the role of the gene that is the selectable marker gene

Explain the role of the gene that is the selectable marker gene in this experiment.

Q: Explain the meaning of the name reverse transcriptase.

Explain the meaning of the name reverse transcriptase.

Q: What is an advantage of making a cDNA library rather than a

What is an advantage of making a cDNA library rather than a genomic library?

Q: What is horizontal gene transfer?

What is horizontal gene transfer?

Q: After four cycles of PCR, which type of PCR product predominates

After four cycles of PCR, which type of PCR product predominates? Explain why.

Q: What needs to happen so the reporter molecule can emit fluorescence that

What needs to happen so the reporter molecule can emit fluorescence that is not quenched?

Q: Describe three possible uses of site-directed mutagenesis.

Describe three possible uses of site-directed mutagenesis.

Q: How is the sgRNA different from certain components of the bacterial defense

How is the sgRNA different from certain components of the bacterial defense system described in Chapter 17?

Q: What is the purpose of using a secondary antibody?

What is the purpose of using a secondary antibody?

Q: What is the purpose of using CNBr in this experiment?

What is the purpose of using CNBr in this experiment?

Q: What is the difference between a gene knockout and a gene knockin

What is the difference between a gene knockout and a gene knockin?

Q: Why is a β-lactoglobulin promoter used?

Why is a β-lactoglobulin promoter used?

Q: In the protocol, why is the nucleus of the oocyte removed

In the protocol, why is the nucleus of the oocyte removed?

Q: Is Carbon Copy a transgenic animal?

Is Carbon Copy a transgenic animal?

Q: What is the difference between a paralog and an ortholog?

What is the difference between a paralog and an ortholog?

Q: Explain why stem cells are not depleted during the life of an

Explain why stem cells are not depleted during the life of an organism.

Q: Are hematopoietic stem cells unipotent, multipotent, or pluripotent?

Are hematopoietic stem cells unipotent, multipotent, or pluripotent?

Q: What is a genetic map?

What is a genetic map?

Q: Why does the probe bind to a specific site on a chromosome

Why does the probe bind to a specific site on a chromosome?

Q: What causes microsatellites to be polymorphic?

What causes microsatellites to be polymorphic?

Q: What is a contig?

What is a contig?

Q: What is the main advantage of using YACs, BACs, and

What is the main advantage of using YACs, BACs, and PACs?

Q: What feature(s) of this pedigree indicate(s)

What feature(s) of this pedigree indicate(s) recessive inheritance?

Q: What is a checkpoint?

What is a checkpoint?

Q: Explain why familial breast cancer shows a dominant pattern of inheritance in

Explain why familial breast cancer shows a dominant pattern of inheritance in a pedigree even though it is recessive at the cellular level.